What is the speed of lander just before it touches surface

Assignment Help Physics

Reference no: EM1361877

Q. Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative to the positive direction of the x axis) of the asteroid's acceleration?

Q. A lunar lander is making its descent to Moon Base I. The lander descends slowly under the retro-thrust of its descent engine. The engine is cut off when the lander is 5.0 m above the surface and has a downward speed of 0.8 m/s. With the engine off, the lander is in free fall.

What is the speed of the lander just before it touches the surface?

The acceleration due to gravity on the moon is 1.6 m/s^2.

Reference no: EM1361877

Questions Cloud

Explain samsung electronic attempt to make profits : Explain Samsung Electronic attempt to make profits from rising consumer demand after the crash. Analyze how both companies attempted to make a profit after the crash

Making an investment with a return : Your firm's weighted average cost of capital is 11 percent. You believe the company should make a particular investment, but the IRR of this investment is only 9 percent.

Capital management practice analysis - automobile industry : Get a list of best practices for talent acquisition and the top five best human capital management practices within the automobile industry.

Body fat and diet program : A 5'9", 140lb 32 year old female has a body fat percentage of 32% when measured using the BodPod. How accurate is her assessment? Where does she stand? Design a one week diet program to help her reach her goals.

What is the speed of lander just before it touches surface : Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative ..

Multiple regression model and independent variables : Propose a business problem that would be best solved by multiple regression analysis. How would you evaluate the quality of the multiple regression model?

Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?

Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

User Account

All Pages