What is the nucleotide sequence of the mrna transcribed

Assignment Help Biology

Reference no: EM13143936

The original sense strand of DNA had the following nucleotide sequence:

TACCCCGCGAAATATTTCCTAATT

What is the nucleotide sequence of the mRNA transcribed from this DNA template?

What is the amino acid sequence of the polypeptide that is produced from the mRNA strand?

Reference no: EM13143936

Questions Cloud

Define face and ultimately improve the complexion : Monochloroacetic acid (HC2H2ClO2) is a skin irritant that is used in "chemical peels" intended to remove the top layer of dead skin from the face and ultimately improve the complexion.

Compute parson s gain or loss on the sale of truck : the accumulated depreciation was $22,500. The liquidation value for the truck is $3,000 on July 1. Compute Parson s gain or loss on the sale of the truck.

What sales volume would two stores have equal profits : Store B has fixed costs of $200,000 per month and a variable cost ratio of 30%. At what sales volume would the two stores have equal profits?

What is the concentration of na+ : A 158-mg sample of Na2CO3 is dissolved in H2O to give 3.00L of solution. What is the concentration of Na+ in parts per million (ppm)?

What is the nucleotide sequence of the mrna transcribed : What is the amino acid sequence of the polypeptide that is produced from the mRNA strand?

Estimate true proportion of incomplete files for all loans : Estimate the true proportion of incomplete files for ALL the bank's commercial loans. Write a statement about the confidence level and the interval you find.

What is the final pressure in the container : What is the final pressure in the container if 705 mL of helium gas at 205 mm Hg is compressed to 255 mL?

Corporation sold land problem : A corporation sold land (with an adjusted basis of $240,000) for $200,000 to its majority shareholder. (a.) What is the company's recognized gain or loss on the sale? (b.) What is the shareholder's adjusted basis in the land?

Probability that tomatoes will be sold by end of day : If there are 75 baskets of tomatoes available to be sold at the roadside stand at the beginning of a day, what is the probability that they will all be sold by the end of the day?

User Account

All Pages