User Account

All Pages

What is the melting temperature of the dna

Assignment Help Biology
Reference no: EM13893620

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this question, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and explain why or why not.

A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?

Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:

GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT

3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.

A. What can be said about the relative proportions of remaining bases in the duplex?

B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:

5' GCATCATCATTTAAACCCGGG 3'

A. What chemical groups protrude from each end of this DNA chain?

B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.

C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?

A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Reference no: EM13893620

Questions Cloud

Write a paper on morality : Write a 15 page paper on morality must be original- Choose a debate that concerns you in some way (I.E. Business Ethics/Law etc). Make a clear decision on which side of the debate you stand on
Explain how you will implement the decision made and reflect : Explain how you will implement the decision made and reflect
Explain at a biochemical level how wine is made : How do evolutionary biologist explain why there are two different ways of handling the pyruvate produced from glycolysis? Be sure to relate your answer to the nature of the Earth 3.5 billion years ago.
Best uses of social media for employer : In terms of recruitment and selection, determine the best uses of social media for an employer to attract high-caliber employees.
What is the melting temperature of the dna : The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Description of the community health education theory : Post 3-4 pages description of the community health education theory from the article you selected. Then, explain how it was applied in the study. Finally, explain how the health education theory in the article contributed to success or failure of ..
What is the recommended route for the power lines : What is the required length of power line required? What is the recommended route for the lines? With that change, what will be the requirement for power lines and what will the route be?
Determine the author tone and perspective on the subject : Look at specific wording (diction) in order to determine the author's tone and perspective on the subject. Describe the tone of the text by providing specific words from the text that suggest the tone and perspective you have determined
Describe the scope of the project and control measures : Describe the scope of the project and control measures - describe the goals and objectives of the project and include a high-level overview of all project deliverables.

Reviews

Write a Review

Biology Questions & Answers

  Teaching-coaching function of advanced practice nursing

Integrate interprofessional collaboration and innovative communication to support and promote the teaching-coaching function of advanced practice nursing

  How numerous map units are they apart

How many 10 micrometer yeast cells could fit across the field. In a guinea pig, black is dominant to brown, and solid colour is dominant to spotted. A heterozygous black, solid-coloured pig is mated with a brown, spotted pig.

  Why yeast cells consume less glucose in presence of oxygen

Sudden addition of oxygen (O2) to a previously anaerobic culture of yeast fermenting grape juice results in a dramatic decrease in the rate of glucose consumption

  Calculate how much sodium chloride to use

For every one molecule of glucose, how much total ATP via substrate level phosphorylation is made during the TCA cycle? 2. For every one molecule of glucose.

  What functional properties of histone proteins

Histone proteins from many different eukaryotes are highly similar in their amino acid sequence, making them among the most highly conserved eukaryotic proteins. What functional properties of histone proteins might limit their diversity?

  Give the phenotypes and expected proportions among progeny

An F1 plant is crossed with a plant that has glossy, cream fruit and nonbitter cotyledons. Give the phenotypes and expected proportions among the progeny of this cross.

  Double-stranded DNA is a cylinder

Double-stranded DNA is a cylinder that is 20A wide and 3.4A longper base pair. E. coli chromosome is a single double-stranded molecule that is 4.6 million bplong.

  What are the parents phenotypes

What are the chances that the next child of the parents of the siblings in part (a) will be a Type B son or a Type A daughter? (show Punnett square)

  Compare and contrast xylem transport and phloem transport

Compare and contrast xylem transport and phloem transport. What happens in a tree as it grows over the course of a singlesummer?

  A cell that completed the cell cycle without undergoing

A cell that completed the cell cycle without undergoing cytokinesis would ?

  What recommendations will the dietitian have for traci

What recommendations will the dietitian have for Traci

  Provide a scientific explanation of a mid-latitude forest

give a scientific description of a mid-latitude forest that contains a small pond within its shady depths. research on

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd