What is the maximum number of processes that it can use

Assignment Help Basic Computer Science
Reference no: EM131091123

Analyze the performance of Luby's shared-address-space algorithm for finding a maximal independent set of vertices on sparse graphs described in Section 10.7.1. What is the parallel run time and speedup of this formulation?
Problem 10.14 Consider Dijkstra's single-source shortest paths algorithm for sparse graphs (Section 10.7). We can parallelize this algorithm on a p-process hypercube by splitting the n adjacency lists among the processes horizontally; that is, each process gets n/p lists. What is the parallel run time of this formulation? Alternatively, we can partition the adjacency list vertically among the processes; that is, each process gets a fraction of each adjacency list. If an adjacency list contains m elements, then each process contains a sublist of m/p elements. The last element in each sublist has a pointer to the element in the next process. What is the parallel run time and speedup of this formulation? What is the maximum number of processes that it can use?

Reference no: EM131091123

Questions Cloud

How many processes can be used to update the l values : Describe an algorithm that uses p1 processes to maintain the priority queue.
What is the parallel run time of this formulation : The last element in each sublist has a pointer to the element in the next process. What is the parallel run time and speedup of this formulation? What is the maximum number of processes that it can use?
Professional research writer : In a 15 point essay, please discuss the religious transformation of the Americas caused by the European missions/colonization of the territory. I think using Kateri (from our Reader) as an example from which to discuss this example would be perfec..
Use the university of phoenix material : Use the University of Phoenix Material: Body Paragraph Template, located to your right under the Materials heading, to draft the body paragraphs for your final essay, due in Week 5.
What is the maximum number of processes that it can use : The last element in each sublist has a pointer to the element in the next process. What is the parallel run time and speedup of this formulation? What is the maximum number of processes that it can use?
Give a business presentation to a small group : 1. What three goals should you accomplish during the introduction of an oral presentation? 2. What three tasks should you accomplish in the close of your presentation?
Compare it with the performance of the 2-d cyclic mapping : You may ignore the overhead due to extra work, but you should take into account the overhead due to communication
Reflect on your writing growth over this quarter : This final reflective essay is not a typical college essay. You can think of it more like a letter to me (your teacher) about your reflections on your learning this quarter. While you should have clear points you are making, you do not need one o..
Information from a variety of sources to compose a paper : In preparation for the Research Paper and by completing your textbook readings, you will be equipped to objectively respond by compiling information from a variety of sources to compose a paper that allows you to write a persuasive analysis of a l..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Strategic planning on the it systems

Discuss two major issues involved with acquiring systems and two major issues commonly faced when maintaining them. Address how each can be minimized or overcome.

  Workbook and a worksheet group in excel

What is the difference between a Workbook and a Worksheet group in excel?

  A disadvantage of the content of approach for lans

A disadvantage of the content of approach for LANs, such as CSMA/CD, is the capacity wasted due to multiple stations attempting to access the channel at the same time. Suppose that time is divided into discrete slots, with each of N stations attempti..

  Reduces the program to an icon on the taskbar

Reduces the program to an icon on the taskbarReduces the program to an icon on the taskbar

  Representing information by predicate-calculus sentences

Represent this information by predicate-calculus sentences in such a way that you can represent the question Is there a member of the alpine club

  What percentage of total cpu time is spent keeping clock

What percentage of the total CPU time is spent maintaining a clock that is accurate to a resolution of one millisecond?

  Dictionary comes from two sources

Implement a spelling checker by using a hash table. Assume that the dictionary comes from two sources: an existing large dictionary and a second ?le containing a personal dictionary. Output all misspelled words and the line numbers on which they o..

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Combines the separately compiled modules of a program

Loader is a system program that combines the separately compiled modules of a program into a form suitable for execution

  Weighted probabilities for x86 processors

Create a procedure that receives a value N between 0 to 100. When the procedure is called, there should be a probability of N/100 that it clears the Zero flag. Write a program that asks the user to enter a probability value 0 to 100.

  Python triangle classification program

Write a C++ version of the Python triangle classification program.

  Explain the two methods which are used to give concurrent

describe the two methods that are used to provide concurrent operations of multiple processes on a single cpu. what are

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd