What is the general algorithm for solving this problem

Assignment Help Basic Computer Science
Reference no: EM13208231

Help a robot move along its track (with spaces numbered 0 through 99) by calculating its new position when given `direction` equal to "forward" or "backward" and `number_of_moves` indicating a non-negative number of spaces. Keep in mind that the robot can't move past the 0 or 99 spot so when it reaches either end it stays there. what is the general algorithm/approach for solving this problem? as a test case, move_robot 10 forward 3 = 13

Reference no: EM13208231

Questions Cloud

How many rows will a truth table require : How many rows will a Truth Table require if there are six variables and three conditions of each variable? Defend your answer.
Compute the molar gibbs energy of fusion : Calculate the molar gibbs energy of fusion (melting) for water at -3degree and 1bar, given that Cp(s)=38J/kmol Cp(l)=75.3j/kmol
Explain what quantity of heat is required to heat : what quantity of heat is required to heat 168 g of copper from -12.2 to + 25.6 degrees C?
Write a program that computes the area of trapezoid : Write a program that computes the area of Trapezoid. Unknown values should be input by user.
What is the general algorithm for solving this problem : what is the general algorithm/approach for solving this problem? as a test case, move_robot 10 forward 3 = 13
To compound monthly which options is more favorable : A local car dealer is advertising a 24 month lease of a sport utility vehicle for 520 payable at the beginning of each month. the lease requires a 2500 down payment plus a 500 refundable security deposit that is refunded at the end of the 24 month..
Explain what is the chemiacl potential of the gas : What is the difference in the chemiacl potential of this gas and an ideal gas at the same pressure and temperature?
Draw the hieararchy chart : Draw the hieararchy chart and then plan the logice for a program that calculates a person's body mass index BMI. BMI is a statistical measure that compares the person's weight and height.
Calculate gdp and loss govt expenditure needed to eliminate : Calculate GDP loss, governemnt expenditure needed to eliminate this loss, and the amount of tax cut needed to eliminate this loss if full employment GDP is $400 billion dollars, unemployment rate 8.9%, and the MPC is 0.8.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Convert the binary numbers to their decimal equivalents

Directions: Convert the following binary numbers to their decimal equivalents.

  The uml class

The UML Class, Sequence Diagrams etc, can be drawn in preferably NetBeans UML, if it is not convenient on that, any other UML tool would do

  How spki be augmented to support policy

Consider a policy that, for reasons of separation of duties, does not allow an entity to exercise the rights it may grant (delegate) to others. How could SPKI be augmented to support such a policy?

  Describe nonrecursive method for finding by link hopping

Describe a nonrecursive method for finding, by link hopping, the middle node of a doubly linked list with header and trailer sentinels.

  Explaining good message digest function

Then calculate message digest on the result. Would this be a good message digest function? Describe. Message digests are reasonably fast.

  How long will it take to reach steady-state value

Investigate the effect of the parameter b on y(t). To do this, plot y versus t for several values of b on the same plot. How long will it take for y(t) to reach 98 percent of its steady-state value?

  Application screen design and layout function

Design focus is on providing the application screen design and layout function for the purchaser. You do not have to worry about the accounting system for the bookshop

  Compare five technologies for in-home internet access

Compare and contrast at least five technologies which are readily available for in-home internet access. You must consider practical as well as technical differences in your comparison.

  Calculate fourier transform of function

Given a function f(x) as follows: f(0) = 2, f(1) = 3, f(2) = 5, f(3) = 4. Calculate the Fourier Transform of f(x), i.e: F(0), F(1), F(2) and F(3)!

  How to perform testing for each development method

Research, write, and give 4-6 page proposal of alternative methods Smith Consulting might consider for finishing Frequent Shopper Program. Describe how Smith would perform testing for each development method.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  The authentication process in a synchronous token system

Describe how the Kerberos authentication process work and outline the main components within the Kerberos environment, their respective functions and the level of security provided by Kerberos. Draw a diagram supporting your explanation Explain..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd