What is an accurate description of the function of warfarin

Assignment Help Biology
Reference no: EM133663322

Question: What is an accurate description of the function of warfarin? It is an antiplatelet. It is a factor Xa inhibitor. It is a vitamin K antagonist. It is a direct thrombin inhibitor.

Reference no: EM133663322

Questions Cloud

Evaluate impact of various dss in any healthcare facility : Evaluate the impact of various DSS in any healthcare facility (hospital, ambulatory, urgent care, nursing home) with clinical, operational, financial.
What would be some of the challenges the us would face : What would be some of the challenges the US would face in adopting a national healthcare system? Discuss at least three challenges.
Describe the morphology of the s. marcescens grown : Describe the morphology of the S. marcescens grown in the broth and in the slant. Include the color, location of growth, and form.
How many ml would you give : Doctor's order is Demerol 1 mg/kg PO q4h prn pain. The child weighs 20 pounds. Demerol comes in 50mg/mL. How many mL would you give?
What is an accurate description of the function of warfarin : What is an accurate description of the function of warfarin? It is an antiplatelet. It is a factor Xa inhibitor. It is a vitamin K antagonist. It is a direct
What would drop rate be if using iv tubing with drop factor : The order reads: Heparin 1.5 units/kg IV bolus once, infuse over 10 minutes. What would the drop rate be if using IV tubing with a drop factor of 22?
What is an any willing provider : What is an "any willing provider" law and how does it impact a health care entity's relationship with health care providers?
Way of predicting the events of stand development : Peak biomass happens during the old-growth stage as a wide variety of organisms have started to work together to use all the available resources and continually
Describe the developing country and the overall challenges : Describe the developing country and the overall challenges compounding environmental health issues and public health in Bangladesh.

Reviews

Write a Review

Biology Questions & Answers

  Explain the functions of the formed elements

1.Define function of the C/CV system, and, in particular the explain the functions of blood. 2.Describe the structures and explain the functions of the formed elements.

  Identify the new strand of dna

Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine

  What statement should the nurse include in teaching

The nurse is teaching a high school health class on diet and exercise. What statement should the nurse include in teaching?

  Describe culture-independent approaches

Biochemical testing represents a culture-dependent approach for bacterial identification. Describe 3 culture-independent approaches which could also be used.

  Describe the differences between puberty and adolescence

Describe the differences between puberty and adolescence. What are some of the milestones that occur that are directly related to puberty?

  Surrounded by a thick wall to for what

The entire protoplast of the cell recedes from the cell wall and is surrounded by a thick wall to for what?

  Do you have any ways to recommend to me

Do you have any ways to recommend to me on how to study the bones of the body? My test is a practical and we have to name 100 bones

  Humans have far fewer genes than originally estimated

Humans have far fewer genes than originally estimated. Please brie?y discuss three reasons why we can get by with only a few more genes than a tiny nematode.

  Major idea or principle about organism development

Briefly describe one major idea or principle about organism development that has come from studying each of these organisms.

  Discuss this concept using the phantom limb phenomenon

Our perceptions of the external world are created by our brains. Discuss this concept using the phantom limb phenomenon to support your argument.

  Genotypes of john parents

What is immediately known about the genotypes of John's parents? Is the genotype of John immediately known?

  About the citadel of the british civil service

In a study about the citadel of the British civil service called

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd