What dna sequence will your gta probe attach to

Reference no: EM133710130

Assignment: Life in Its Biological Environment Laboratory- Lab- Paternity Testing with DNA Fingerprinting

Introduction

DNA "fingerprinting" is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.

The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe's sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child's biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.

I. Review information about the process of geneticfingerprinting.You can perform an Internet search on the subject if you do not have other reference materials.

II. You have been given the following DNA samples:

Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG

Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG

Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG

Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

III. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.)Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary's DNA as an example.

IV. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell.This chart represents the "gel" that separates DNA by size.

	Mary	Joe	Dan	Jacob
5
6
7
8
9	CCTAGACGG
10
11
12
13
14
15
16
17
18
19
20

The first restriction fragment produced in Mary's DNA has been done for you as an example. It was placed in Mary's column because it comes from Mary's DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.

V. You have decided to use a probe that is a small piece of DNA with a sequence of "GTA" that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?

	Mary	Joe	Dan	Jacob
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

VI. Using the Highlighter feature of your word processing program, highlight all of the sequences in the "gel" abovethat contain the complementary sequence determined in #V. These sequences will have the radioactive probe attached to them.

VII. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as "genetic markers."We will now fill in the "film" to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.

VIII. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary's baby?

IX. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

Reference no: EM133710130

Questions Cloud

What methods would you employ to limit your risk : what methods would you employ to limit your risk of being infected? If you were to be infected with this pathogen, what are the most effective treatment options

Develop an emerging global mindset : Reflect on and continuously progress their own professional development, enhancing their intellectual agility and adaptability

Power to intervene in collective bargaining activities : To what extent should the federal government have the power to intervene in collective bargaining activities?

James williams buys and sells used lawn equipment : James Williams buys and sells used lawn equipment in Georgia such as tractors and mowers. He cleans the equipment and makes some minor repairs

What dna sequence will your gta probe attach to : You have decided to use a probe that is a small piece of DNA with a sequence of GTA that has been labeled. What DNA sequence will your GTA probe attach to?

Electronic communications privacy act : What is the Electronic Communications Privacy Act?

Create liability for fraud or misrepresentation : Which of the following statements, if false, is most likely to create liability for fraud or misrepresentation?

Computer to print counterfeit money : You receive a complaint that the person living at 1 Main Street is using his computer to print counterfeit money.

Opponents faith views on the death penalty : For and against the death penalty the best safeguards that should be put in place to address concerns of your opponents faith views on the death penalty.

User Account

All Pages