Reference no: EM133200669
Discuss the function in detail of each of the following RNA polymerase II transcription factors.
TFIIB
TFIIE
TFIIF
TFIIH
What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?
Discuss in detail how the 5' cap is formed in eukarytotic mRNAs.
What makes the 3' end of eukaryotic mRNAs unique? Describe how this is added.
What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.
What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?
Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.
How is thymidylate derived?
What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?
Describe the condition known as Gout and include in your discussion how it is caused.
What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?
Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)
Define the following terms: codon, reading frame and peptide sequence.
Review the following coding DNA Sequence and its template strand, and provide the sequence for the corresponding mRNA strand in 5' to 3' orientation:
5'-CCGGCTAAGATCTGACTAGC-3' (coding)
3'-GGCCGATTCTAGACTGATCG-5' (template)
Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation or termination codons.
5'- GCUAGUCAGAUCUUAGCCGG -3'
Consider the following mRNA sequence, translate each codon into its corresponding amino acid and provide the peptide sequence:
5'-CGG CUA AGA UCU GAC UAG -3'