What causes lesch-nyhan syndrome

Reference no: EM133200669

Discuss the function in detail of each of the following RNA polymerase II transcription factors.

TFIIB

TFIIE

TFIIF

TFIIH

What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?

Discuss in detail how the 5' cap is formed in eukarytotic mRNAs.

What makes the 3' end of eukaryotic mRNAs unique? Describe how this is added.

What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.

What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?

Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.

How is thymidylate derived?

What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?

Describe the condition known as Gout and include in your discussion how it is caused.

What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?

Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)

Define the following terms: codon, reading frame and peptide sequence.

Review the following coding DNA Sequence and its template strand, and provide the sequence for the corresponding mRNA strand in 5' to 3' orientation:

5'-CCGGCTAAGATCTGACTAGC-3' (coding)

3'-GGCCGATTCTAGACTGATCG-5' (template)

Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation or termination codons.

5'- GCUAGUCAGAUCUUAGCCGG -3'

Consider the following mRNA sequence, translate each codon into its corresponding amino acid and provide the peptide sequence:

5'-CGG CUA AGA UCU GAC UAG -3'

Reference no: EM133200669

Questions Cloud

Determine how you will measure the marketing activities : Determine how you will measure the marketing activities (i.e., what metrics will be used to determine success or failure).

Contemporary american society : What role do traditional media (radio, TV, newspapers, etc.) play in contemporary American society?

Definition of corporate social responsibility : a brief definition of "Corporate Social Responsibility" followed by the APA reference for the term; this does not count in the word requirement.

Understanding of what human resources is : Now that you have a better understanding of what human resources is, let's see it in action. Let's go back to the Starbucks case we started with; remember, Howa

What causes lesch-nyhan syndrome : PHA 6535-University of Florida-What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?

How could the city benefit from a team : How could the city benefit from a team? Who/what will be the largest competitors for your team? Provide a SWOT analysis of the proposed city.

Describe the effect the current product brand : Situation Analysis: Describe the effect the current product brand has on consumer behavior.

Find dividends and capital gains : The expected pretax return on three stocks is divided between dividends and capital gains in the following way:

Geographic diversification strategy : Describe Walmart's Geographic Diversification strategy (Hint: Global centralized? Multidomestic? or Transnational strategy?).

User Account

All Pages