What are the three main ingredients in photosynthesis

Assignment Help Biology
Reference no: EM131130313

Question 1

What is the key to the recognition of codominance?

A- The alleles affect more than one trait.
B- The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
C- The heterozygote expresses the phenotype of both homozygotes.
D- The trait exhibits a continuous distribution.
E- The dominant allele is not always expressed.

Question 2

Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.
What would be the genotype of individual number 1?

A- None of the alleles can be determined
B- D_
C- dd
D- Dd
E- DD

Question 3

Answer the question using the pedigree above. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl?

A- 0%
B- Cannot be determined from the data
C- 50%
D- 25%
E- 12.5%

Question 4

My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?

A- 25%
B- 33%
C- 67%
D- 50%
E- 75%

Question 5

Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?

Question 6

Based on the phylogenetic tree below, which of the following is most correct?

A- HIV is not related to SIV because Humans did not evolve from chimps
B- HIV evolved multiple times from SIV
C- Since humans are more evolved than chimps, HIV is more evolved than SIV
D- HIV M evolved from HIV O

Question 7

The image below shows evidence from a RFLP analysis from your DNA forensics lab. The defendant testified that the blood on his clothes was his own. What statement below best fits this testimony.

A- He has a valid point because some of the lines seem to match up.
B- It could have been anyone's blood.
C- He is telling the truth because he is under oath
D- The pattern clearly shows that the blood matches the victims blood
E- There is no way to tell if the blood really is his because it had already dried

Question 8

What is the approximate probability of someone else having the same STR Profile as the one in this figure:

Use the table below to calculate the probability.

Locus Allele Frequency
D3S1358 12 0.015
D3S1358 13 0.015
D3S1358 14 0.1341
D3S1358 15 0.2896
D3S1358 16 0.2287
D3S1358 17 0.1616
D3S1358 18 0.1616
D3S1358 19 0.0152
VWA 12 0.015
VWA 14 0.1311
VWA 15 0.1189
VWA 16 0.186
VWA 17 0.2774
VWA 18 0.189
VWA 19 0.0884
VWA 20 0.015
FGA 18 0.015
FGA 19 0.061
FGA 20 0.125
FGA 21 0.1799
FGA 22 0.2287
FGA 23 0.1311
FGA 24 0.1463
FGA 25 0.0945
FGA 26 0.0183
FGA 27 0.015

A- 39 out of 10,000
B- 12 out of 1000
C- 12 out of a billion
D- 39 out of 1,000,000 people

Question 9

What is the difference between discovery science and hypothesis-driven science?

A- Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.
B- Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.
C- Discovery science "discovers" new knowledge, whereas hypothesis-driven science does not.
D- There is no difference between them.
E- Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.

Question 10

Aside from Natural selection, Darwin was the first biologist to propose:

A- Mutations in the genes can lead to new variation
B- genetic inheritance, stonger genes in parents lead to stronger genes in the offspring
C- Tree like structure to describe evolution
D- Darwin did not propose anything new aside from natural selection.
E- The evolution of species over time

Question 11

Which of these would Darwin not agree with:

A- The idea that individuals striving to survive leads to better adapted species
B- Evolution via natural selection requires long amounts of time
C- Common ancestry for all of life
D- Significant weight should be given to geology and fossils as evidence of evolution

Question 12

Natural selection always results in ______.

A- an increase in the size of a population
B- increased genetic variation
C- offspring better adapted to a future environment
D- a decrease in the size of a population
E- offspring better adapted to their parents' environment than were their parents

Question 13

Which of the following is a characteristic of a non-trivial organization system?

A- Only experts in the field would be able to understand it
B- You get more out of it than what you put in it.
C- Tradition trumps new evidence
D- Organized alphabetically

Question 14

For the following questions, determine the ones that can be addressed by Science.

A- How old is the Earth?
B- What morphological characteristics were likely present in the common ancestor of humans and chimps?
C- Why was the Earth created?
D- How does coffee affect ulcers?
E- Are humans most closely related to chimpanzees?

Question 15

Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:

A- Populations never come into contact with each other
B- Offspring fail to reproduce
C- Male and female gametes fail to unite in fertilization.
D- Mating behaviors are not recognized by different organisms
E- Embryos are inviable and do not survive more than a few days
F- Genitalia structures are far too different to allow successful copulation

Question 16

Match the following species concept with one of its disadvantages.

A- Biological species concept
B- Phylogenetic species concept
C- Morphological species concept

Question 17

Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.

A- All of the different varieties of dogs that were artificially selected
B- Relatively young earth - less than 10 thousand years.
C- The fossil record
D- Adaptations acquired during life passed on to offspring
E- ack of homology among organisms
F- Marsupial radiation
G- All organisms share the same four DNA nucleotides (A T G C)
H- modern interpretation of the bible
I- Existence of vestigial organs
J- Humans evolving from modern day chimpanzee

Question 18

Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?

A- Speciation events
B- Nodes
C- Branches
D- Common ancestors
E- Internodes

Question 19

Which of the following best describes an enzyme?

A- They lower the amount of energy present in the substrate.
B- They lower the energy of activation of a reaction by binding the substrate.
C- They raise the energy of activation of a reaction by binding the substrate.
D- They heat up the reactants so that reactions occur at a greater speed.

Question 20

A pair of sex chromosomes found in a human male is most like

A- identical twins.
B- a pair of blue jeans.
C- a bride and groom.
D- a knife, fork, and spoon.

Question 21

What are the three main ingredients in photosynthesis?

A- Nitrogen
B- Carbon dioxide
C- Simple sugars
D- Oxygen
E- Light
F- ATP
G- Water

Reference no: EM131130313

Questions Cloud

Referenced in accordance with the qutls referencing guide : Business Law Assignment:In 3500 - 4000 words please address one of the following options. Your assignment should include an introduction and a conclusion. It should be referenced in accordance with the QUTLS referencing guide and include a biblio..
Identify one fact that think that chief justice ostrander : Go to chapter 44 - Based on your reading of the Dodge v. Ford Motor Co. case, identify only one fact (from the case) that you think that Chief Justice Ostrander relied on to determine that Ford Motor Co. was wrongfully withholding dividends (money..
What are the various stages in a product life cycle : How can international trade take place according to the technological gap model? What criticisms are leveled against this model? What does the product cycle model postulate?
The characteristics of an it-dependent strategic initiative : 1. Describe the characteristics of an IT-dependent strategic initiative that will lead to a sustainable competitive advantage. Please review the attached PPT: "Strategic Information Systems: Summary" for information to assist in your response.
What are the three main ingredients in photosynthesis : What are the three main ingredients in photosynthesis? Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?
Review your family history of chronic illnesses : You will design a personal self-care preventive plan to address any area in your life which you deem potentially at risk for disease.
Pick a product or service and prepare an elevator speech : 1. Pick a product or service and prepare an elevator speech (less than a hundred words, no more than thirty seconds). Rehearse the draft out loud to see how it sounds and post or present it in class.
Prepare loan amortization schedule : Messineo LLC borrowed $15,000 at a 14% annual rate of interest to be repaid over 3 years. The loan is amortized into three equal annual end of year payments. As the CFO of Messineo, LLC you must prepare a report of the pertinent information in a shor..
Providing and marketing a standard advice service : Lannion and Co. is engaged in providing and marketing a standard advice service. Summarised results for the past two months reveal the following:

Reviews

Write a Review

Biology Questions & Answers

  Weight are governed byseveral genes

Quantitative traits such as height and weight are governed byseveral genes that usually contribute in an additive way to the trait. This is called

  Benefit of secret bidding

How would a polygraph test violate a job applicants' right to privacy? A benefit of secret bidding would be:

  Concepts and perspectives about leadership

Think about the concepts and perspectives about leadership, followership, and ethics to which you have been exposed so far. Perhaps your interest in a particular person or personality type has been piqued, or perhaps you wish to further explore a con..

  Effect of an acetylcholinesterase inhibitor

Compare the short term effect of an acetylcholinesterase inhibitor on the heart to its effect on muscles that cause inhalations and exhalations

  Why is the term hominid cladistically indefensible

The term "hominid" has traditionally been used to refer to species in the line the leads to modern humans after the divergence between that line and the line that leads to modern chimpanzees.

  What are the genotypes of the parents

In cats, the X-linked allele O converts the black pigment found in the fur into an orange pigment. Heterozygous females are mosaics of orange and black pigmented fur.

  What are pros and cons of international food relief programs

Programs have been established to supply food from Western nations to starving people in Africa. Some people argue that such food programs, which may have short term benefits, actually increase the threat of starvation in the future. What are the ..

  H-1 receptor antagonists

Discuss how these drugs act on the receptors to prevent the typical symptoms of allergic rhinitis.

  Do you have any ways to recommend to me

Do you have any ways to recommend to me on how to study the bones of the body? My test is a practical and we have to name 100 bones

  Q1 rayed craters on the moon as in copernicus formed during

q1. rayed craters on the moon as in copernicus formed during an intense early period of bombardment prior to the

  Emergence of the virus and methods of control

Please note the focus of the essay is to study material related to the emergence of the virus and methods of control. very brief introduction to the virus discuss modes of transmission and what the known vectors for transmitting Chikungunya virus ..

  Explain how you think this factor will impact cell growth

What three other factors that could have influenced how the cells were grown (this can be a substance or an environmental condition) and explain how you think this factor will impact cell growth.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd