Reference no: EM1345033
Question 1: The majority of viruses that have been identified to date cause disease.
Answer
True
False
Question 2: Viruses were first distinguished from other microorganisms, such as bacteria, based on which of the following (select one)?
Answer
A. Nucleic acid sequence
B. Size
C. Smell
D. Morphology in a light microscope
Question 3: You isolate a virus from a patient and are able to get a partial sequence of one of the viral proteins: Protein X
Sequence of Protein from Virus X SDNDLSLEDF
In addition, you are able to get partial sequence of the viral genome by deep sequencing of a clinical sample.
5’GAAGUCUUCCAGUGACAGAUCGUUGUCACU3’
Given this information, it is possible to determine that this virus is (select one)?
Answer
A. (+) RNA Virus
B. (-) RNA Virus
C. Retrovirus
D. (+) DNA Virus
Question 4: There are viruses that are known to infect which of the following entities (select all that apply)?
Answer
A. Animal Cells
B. Protists
C. Bacteria
D. Archaea
E. Plant cells
F. Prions
Question 5: Which of the following are characteristic of viral reproduction/replication (Select all that apply)?
Answer
A. The burst phase occurs just before the eclipse period.
B. Viruses require an eclipse period before infectious viral particles appear outside the cell.
C. Viruses undergo binary fission during eclipse period.
D. Viruses must assemble preformed subunits before whole viral particles can assemble
E. The latent period is longer than the eclipse period.
Question 6: A progeny infectious particle of a virus is called a [x]?
Question 7: Match the following viral assays with the process or macromolecule they are measuring.
Answer
Polymerase Chain Reaction
Read Answer Items for Question 7
Plaque Assay
Read Answer Items for Question 7
Hemagglutination Inhibition
Read Answer Items for Question 7
Deep Sequencing
Read Answer Items for Question 7
Polymerase Assay
Read Answer Items for Question 7
Answer
A. Genome sequence
B. Cytopathic Effect
C. Viral protein
Question 9: [x] are biologically active agents that are even more simple than viruses. These entities are composed of only a single molecule of RNA and can only infect plants.
Question 10: You are working in a clinical diagnostic laboratory and you receive a clinical sample from a pateint with a severe respiratory infection. Your perform a plaque assay on this clinical sample at various temperatures and using several different respiratory cell lines, but you never observe plaques. Based on this information, can you conclude that there are no viruses in this sample? Justify your answer in 3-4 sentences
Question 11: Due to the many diseases caused by viruses, we generally regard viruses as bad. Nevertheless, viruses may also have positive effects on organisms. Recent studies have shown that the mucosal linings of animals are highly enriched in bacteriophage. Explain in 2-3 sentences how this might be beneficial for an animal.
Question 12: If 10,000 infectious viral particles are added to tissue culture well containing 10,000 susceptible and permissive cells, which of the following will occur (select all that apply)?
Answer
A. A percentage of the cells will be infected with multiple viral particles
B. The Multiplicity of Infection (MOI) will be 1
C. Only one infectious cycle will occur
D. The Multiplicity of Infection (MOI) will be 10
E. A percentage of the cells will only be infected by one viral particle
F. Some of the cells will be uninfected.
Question 13: For the Herpes Simplex virus, only about 0.5% of viral particles added to a cell will result in a complete replication cycle (i.e. enter the cell, replicate its genome and exit the cell). In contrast, for lambda phage nearly 100% of the particles will be capable of completing a successful replication cycle. In 3-4 sentences, provide a plausible reason for the difference in active viral particles with HSV and lamda phage.