Transcription begins at the first capital letter

Assignment Help Biology
Reference no: EM131701831

This gene is transcribed from left to right, and transcription begins at the first capital letter.

5'-agcaacctgAAACAGACACCATGGTGCACCTGACTCCTGAG

3'-tcgttggag TTTGTATGTGGTACCACGTGGACTGAGGACTC

Write the base sequence of the RNA (beginning with 5' end at left of page) that is transcribed from this region of the gene.

Reference no: EM131701831

Questions Cloud

Axon change with threshold stimulus : Why does the membrane potential between the axon hillock and axon change with threshold stimulus?
What team leader management style would be most effective : What team leader management style would be most effective in leading a team in which you were a member?
Population of healthy cells undergoing meiosis : If you were analyzing a population of healthy cells undergoing meiosis and observing a peak rising at the "0.5 relative DNA content," what type of cells
Calculate the roi for each division for last year : ACC804 Advanced Management Accounting - Calculate the ROI for each division for last year and the current year, as well as the two components of ROI
Transcription begins at the first capital letter : This gene is transcribed from left to right, and transcription begins at the first capital letter.
Discuss about the effects of business intelligence : Discuss about the Effects of business intelligence and analytics on business performance.
Immune response to various pathogens : What is it about T cells, then, that their deficiency can lead to so many problems with immune response to various pathogens?
Analyze a place at the local regional and global scale : Analyze a place at the local, the regional, and global scale. Look at country using Google Maps satellite view and map view and record observations and pattern.
Benefits of cardiovascular exercise : 1. Identify at least three benefits of cardiovascular exercise? 2. Identify at least three benefits of muscular strength and endurance training.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd