Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Write a function called compute_discount_amount() that determines the total discount , in dollar, for a customer based on age and student /employment status. the function accept the ticket price (floating -point) and age (and integer) as input parameters and does the following to determine the discount.
a) prompts the user for the student status of customer. the user should enter "y" if they are currently a student ; "n" otherwise b) prompt the user for employment status of customer. the user should type "y" if they are a WSU emlployee; "n" otherwise. a customer may be student and an employee. a customer is consider a senior citizen if they are 65 year older. the following discount should be applied: 9% for employees, 10% for senior citizen, 11% for students, and 12% for student who are also employees. the function return the value of the ticket price time the discount percentage.
Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.
When a process moves from running to idle, the state of the machine has to be saved. Obviously this cannot mean the whole state, as there would be no place to save it. Just what information has to be saved?
What are some of the more popular database management systems? Why use Oracle?
Explains a set of recommendations for achieving greater maturity that addresses funding priorities. Explain a set of recommendations for achieving greater maturity that addresses key management capabilities.
If organization has three information assets to evaluate for risk management as shown in accompanying data, which vulnerability must be evaluated for additional controls first? Which one must be evaluated last?
What interface does an application need to use if it wants to get updates on the current position of the mouse cursor as the mouse is being moved? How does the program get the x,y coordinates of the mouse cursor?
How do components of your computer system interact within system? What improvements or additions to your system do you think would benefit you or make system more user-friendly? Why?
Create a JFrame that uses BorderLayout. Place a JButton in the center region. Each time the user clicks the JButton, change the background color in one of the other regions. Save the file as JColorFrame.java.
Given the list of all the product prices and wholesale prices as well as a list of all the items sold for each product calculate the net profit for all the products.
The area of a circle is pi multiplied by the square of the radius
Find Newton%u2019s interpolating polynomial for the function ;
Create an application that will allow a new customer to order a house. You'll allow the customer to choose among four models (Aspen, Britattany, Colonial, and Dartmoor) by creating separate ButtonGroups.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd