The company declared dividends of 6000 on preferred stock

Questions Cloud

User Account

All Pages

Reference no: EM13584315

Reference no: EM13584315

Assignment Help Accounting Basics

Burke Company shows the following condensed income statement information for the year ended December 31, 2010:

Income before extraordinary items $29,936

Less: Extraordinary loss (net of income tax credit) (2,176)

Net Income $27,760

The company declared dividends of $6,000 on preferred stock and $17,280 on common stock. At the beginning of 2010, 10,000 shares of common stock were outstanding. On May 4, 2010 the company issued 2,000 additional common shares and on October 19, 2010 it issued a 20% stock dividend on its common stock. The preferred stock is not convertible.

Required:

1. Computer the 2010 basic earnings per share.

2. Show the 2010 income statement disclosure of basic earnings per share.

3. Draft a related note to accompany the 2010 financial statements.

Question a political strategist believes that at least 58 : question a political strategist believes that at least 58 of voters in a certain state support his candidate. he then

David oliver and umar ansari with capital balances of 28000 : david oliver and umar ansari with capital balances of 28000 and 35000 respectively decide to liquidate their

Compute the gross margin ratio both with and without : use the following selected data from success systems income statement for the three months ended march 31 2014 and from

Why are frameshift mutations insertions and deletions more : 1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

The company declared dividends of 6000 on preferred stock : burke company shows the following condensed income statement information for the year ended december 31 2010income

1 what did the astronomer edwin hubble discover about : 1 what did the astronomer edwin hubble discover about galaxies in the 1920s?2 what formula is used to calculate the

Give an example of a researchstatistic study that you : give an example of a researchstatistic study that you encountered this week in your life outside of this course. this

Johnson inc owns control over kaspar inc johnson reports : johnson inc. owns control over kaspar inc johnson reports sales of 400000 during 2013 while kaspar reports 250000.

Using the internet or strayer databases research the : each state within the united states has its own unique judicial selection process within its own court system.using the

Basic earnings per share

Basic earnings per share related to income before extraordinary items =

Income before=

extraordinary items=

Extraordinary loss=