Specific amplification of each individual allele

Assignment Help Biology

Reference no: EM132403891

The following is a series of alleles for the "DUH" gene, (I possess them all), please review these sequences and perform the tasks requested.

1.CGGGGGCTTTCAAACGAGGAGACTTATAGCTCCGATTAGACCGGAGAGATATAGAC 2.CGGGGGCTTTCAAGTGAGGAGACTTATAGCACCGAATAGACCGGAGAGATATAGAC
3.CGGGGGCTTTCAACGAGGAGACTTATAGCTCCGAATAGACCGGAGAGAATATAGAC 4.CGGGGGCTITCAAACGAGGAGACTTATAGCTCCGATTAGACCGGAGAGATATAGAC 5.CGGGGCCITTCAAACGAGGAGACTTATAGCACCGATCAGACCGGAGAGATATAGAC 6.CGGGGGCTTTCAAACGAGGAGACTTATAGCACCGATTCGACCGGAGAGATATAGAC 7.CGGGGGCTTTCAAACGAGGAGACTTATAGCTCCGATTACACCGGAGAGATATAGAC 8.CGGGGGCTTTCAAACGAGGAGACTTATAGCTCCGATTAGCCCGGAGAGATATAGAC 9.CGGGGGCTTTCAAACGAGGAGACTTATAGCACCGATTAGAGCGGAGAGATATAGAC

They are all 56bp long so you can refer to start and stop points as by base number. Try the following mental exercises and post thoughts in webtalk. There is no perfect answer here, many ideas will be workable, I just want you to put into practice what you have been reading.
• Design a 10bp primer set that will amplify all the alleles.
• For each individual allele, select a 10bp probe that will allow for its detection.
• Design 10bp primer sets that will allow specific amplification of each individual allele.
• Can a restriction enzyme(s) be used in the detection of individual alleles?

Reference no: EM132403891

Questions Cloud

Chain of hairdressing salons : You have been asked by the owner of a chain of hairdressing salons to access current health and safety legislation and related documentation

What are the negative effects of poor data : From this chapter, in addition, the previous ones, we continue to enhance our knowledge and understanding about IG best business practices, and how good.

How does this transform change management : Describe some of the most important characteristics relevant to EA governance. How does this transform "change management"?

How the courts are denying the victim the right : If that right is getting taken away from them, then this is a clear representation of how the courts are denying the victim the right to participate

Specific amplification of each individual allele : Design a 10bp primer set that will amplify all the alleles and For each individual allele, select a 10bp probe that will allow for its detection.

Rescission of the purchase agreement : Could the buyer force the seller to sell at a reduced price, or was rescission of the purchase agreement his only remedy?

Software code affect the overall security of the system : How does the source of your software code affect the overall security of the system? Justify your position for a general system.

Write a general conclusion for the case : If I have to IRAC multiple issues in a particular case, will I still have to write a general conclusion for the case (like a summary).

Briefly state and name the countries and organizations : From this research revelation in our chapter 11, briefly state and name the countries and organizations identified as the targeted victims?

User Account

All Pages