Reference no: EM131442660
A. MICROBIOME
1) In the accompanying microbiome dataset 1, which includes the known 16SrRNA sequences of 5 different gut microbiota, identify which species the last sequence (seq5) corresponds to.
2) Identify a substring in each sequence of no more than 30 bases that uniquely distinguishes each species but comes from the same region of the sequence. Report the coordinates (relative to seq1) where your substring came from, and write out the 5 unique sequences as they would appear in a multiple alignment.
3) Why do you think the region where your substring came from is more variable than most of the rest of the sequence?
4) Dataset 1 and dataset 2 were derived from 16s sequencing of a malnourished and well fed individual respectively, with all other variables (e.g. age, sex) perfectly matched. Using the substrings above, count the number of 16s rRNA derived from the 5 species you identified above. The "find" function in excel may be useful here. You can assume that there exist no other species with the same substring as those that you are measuring. Report your counts in table format with column headings: dataset 2, dataset 3, and row labels: your 5 species. (3 marks) N.B. ".tab" (tab-delimited) files can be opened with Excel. For Mac users, you may need to change it to ".txt" before opening.
6) Which of the 5 species differs the most in its abundance between the two individuals?
B. CONSERVATION AND POSITIVE SELECTION OF NON-CODING RNA
Many non-coding RNAs are turning out to have very important conserved functions. The HAR1A (Human accelerated region 1) sequenceis expressed in human cerebral cortex during early human development. Part of the sequence appears to be under strong positive selection and is referred to as Human accelerated region 1
1. Use BLAT to call up the sequence forHuman Accelerated Region A (HAR1A) using the following segment of human HAR1A: AGACGTTACAGCAACGTGTCAGCTGAAATGATGGGCGTAGACGCACGT
Show the screen shot.
2. Is the conservation limited to this short search sequence? Show data.
3. Do a CLUSTALW alignment of the region in 1) plus 100 nucleotides from either side for vertebrates ranging from Human to fish. Use at least 10 species and include available primates as well as the species in Question 5. Show the alignment.
4. Show the graphical phylogenetic relationship using the alignment.
5. How many changes are present between the Human and Chimp? Chimp to Mouse? Chimp to Opossum?
C. GENEMANIA AND BIOGRID
Links to these sites and descriptive material in Nucleic Acids Research are shown below.
GENEMANIAhttps://genemania.org/
NAR: https://academic.oup.com/nar/article/38/suppl_2/W214/1126704/The-GeneMANIA-prediction-server-biological-network
BIOGRID https://thebiogrid.org/
NAR: https://academic.oup.com/nar/article/45/D1/D369/2681732/The-BioGRID-interaction-database-2017-update
1. Go to Genemania.
Choose a protein of interest that is present in any of the species (dropdown icon, upper left panel). On the right side of the upper left panel is a drop down menu to toggle on/off various types of interaction. Turn off everything except Physical interactions. Show the output.
2. The image will show reported physical interactions as well as predicted interactions. The displayed information will show on the right hand side of the page. Turn off everything except the one you searched for. Try toggling on/off the various types of data on the left hand menu. Show at least three variations on the theme. Be sure to include Attributes alone.
3. Go to BioGrid and input the same protein/organism. The initial image displays all information. On the Switch View panel click the Interactors, Interactions, and then Network. Show image of the last one. How does the view compare to Genemania?
Attachment:- Assignment Files.rar
|
How have changes in employee roles
: After reading "The Corporate Shift: How Millennials Are Changing the World" article in the Module Four Reading and Resources section, discuss the following: How have changes in employee roles as a result of organizational shifts influenced individu..
|
|
Pros and cons of clean coal energy
: Need a paper written on the pro's and con's of "clean coal energy" - Need the main points to be Intro and conclusion
|
|
Map identifying the location of the chosen site
: Choose one landmark, monument, natural wonder, or city in South America. Create an informative and detailed brochure, report, slide show presentation, or movie about your chosen place.
|
|
Identify the type of business and ownership
: Identify the type of business and ownership and write a concise summary of the case study. (Remember to reference the source)
|
|
Show the graphical phylogenetic relationship
: Bio 331 2017: Assignment. Do a CLUSTALW alignment of the region in 1) plus 100 nucleotides from either side for vertebrates ranging from Human to fish. Use at least 10 species and include available primates as well as the species in Question 5. Sh..
|
|
What is the shape of the supply curve for tickets
: Say that a certain stadium for professional football has 70,000 seats. What is the shape of the supply curve for tickets to football games at that stadium? Explain.
|
|
Union victory over the confederate forces
: What was Lincoln's political position on slavery prior to 1860? Why did his election lead to southern secession? In your opinion, what were the top three factors that led to a Union victory over the Confederate forces?
|
|
Explain the interdependence of banks and railroads
: What were the issues created by the development of the railroads that created the need for a new and different management and business structure for railroads?
|
|
Explain how you would build your work breakdown structure
: If you were managing an agile development project, explain how you would build your work breakdown structure (WBS). Explain the di erences between unit testing and system testing.
|