Reference no: EM131134574

1. A SNP marker has 3 alleles in a population: A, T and C. The population frequencies of the 3 alleles are pA = 0.2, pT = 0.5 and pC = 0.3, respectively. Assuming random mating (Hardy-Weinberg equilibrium), the frequency of A/T genotypes is______ , the frequency of A/C genotypes is______ and the frequency of T/C genotypes is______ .

2. A boy who is born to healthy parents that are siblings (brother and sister) is an example of______ mating and may be at higher risk for______ diseases.

3. A point mutation that changes a codon from GAU to GAA is an example of a ________ mutation.

A. synonymous

B. missense

C. nonsense

D. harmful

E. silent

4. The shorthand notation for a normal female karyotype is ________.

A. 47,XXY

B. 48,XXYY

C. 46,XY

D. 44,XX

E. 46,XX

5. A chromosome with a centromere located in the middle of the chromosome roughly equidistant from the two telomeres is ________.

A. metacentric

B. submetacentric

C. telocentric

D. acrocentric

E. eccentric

6. The ________ technique can be used to collect a sample of fetal cells for genetic testing using only a blood sample from a pregnant woman.

A. chorionic villi sampling

B. amniocentesis

C. fetal cell sorting

D. nuclear fission

E. none of the above.

7. Which of the following is NOT a DNA repair mechanism that exists in humans?

A. Photoreactivation repair

B. Double-stranded break repair

C. Excision repair

D. Mismatch repair

8. An oncogene can arise by a ______ of a ______.

9. The mature mRNA transcript for a gene with one exon is originally

5' AUGAGGGAAUCCCCUAGGUGA 3'

and a mutation inserts an additional G nucleotide after position 7 in the DNA sequence so that the mutated gene produces the modified mature mRNA transcript

5' AUGAGGGGAAUCCCCUAGGUGA 3'

The amino acid sequence of the protein coded by the original gene is ______ and the amino acid sequence of the protein coded by the mutated gene is ______ . This is an example of a ______ mutation. If 3 G nucleotides were instead inserted after position 7 it would be an example of a ______ mutation.