User Account

All Pages

Short sequences of dna with a message

Assignment Help Biology
Reference no: EM132016514

Sequence 1 and sequence 2 are short sequences of DNA with a message. To decipher the message, you will need to first transcribe and then translate the sequences. Using the single letter code of each amino acid obtained upon translating the sequence, crack the message contained. Please note that there are only 20 amino acids. Therefore, you may need to insert any/all of the letters B, J, O, U, X, Z to complete the message.

DNA Sequence 1: 3'- CGGGGGCGGTAG

TCCTCAACCTAGTGGGTGTGG - 5'

DNA Sequence 2: 3'- AGGACGTA

GCTTTTAACGCTCTAAAGGAAATTA- 5'

Reference no: EM132016514

Questions Cloud

Percent of insulin receptors : If the ambient blood concentration of insulin in liver tissue is 5*10^-12M, what percent of insulin receptors on these liver cells will have bound insulin?
What economic and political similarities do we have : What can we learn from this part of the series for today's economics? In other words, what economic and political similarities do we have in today's economic.
What health concerns can result from obesity : What environmental factors do you believe have contributed to obesity? What health concerns can result from obesity?
Prepare and present a case analysis : Prepare and Present a Case Analysis: World Relief, NO PLAGIARISM, Overall analysis should not exceed 4 pages.
Short sequences of dna with a message : Sequence 1 and sequence 2 are short sequences of DNA with a message. To decipher the message, you will need to first transcribe and then translate the sequences
Identify the activities that generate negative externalities : Identify three activities that generate negative externalities and three activities that generate positive externalities.
Write a report that compares and contrasts the two models : Take on the role of a case manager, and prepare a paper on the 2 primary models used in delivering LTC to present to potential long-term care client families.
Identification of important terms : Ignoring what the enzyme does, by which mechanism would an organic chemist use to explain this reaction. Include in your mechanism the correct
What do you mean by rational ignorance : What do you mean by ‘Rational ignorance? How rational ignorance impact on economic development of a country? Explain giving examples.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd