Sequence has experienced a spontaneous

Reference no: EM13527807

Assume that the sequence below has experienced a spontaneous
mutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication. Write the new sequence of the complementary strand as a result of this shift and identify the type of substitution (if any) for each base on new complementary strand compared to the original complementary strand.

Sequence (5’ TO 3’)
CGGTGTGACACTAGGTAGTCTAACGAGCTCACGGGCAGGGCTATATGTTGCAAAGTCGTAGGTCAC

Complementary sequence (3’ TO 5’)
GCCACACTGTGATCCATCAGATTGCTCGAGTGCCCGTCCGATATACAACGTTTCAGCATCCAGTG

Reference no: EM13527807

Questions Cloud

Research the kyoto agreement and the montreal protocol : Write a paragraph that research the Kyoto Agreement and the Montreal Protocol, what impacts

Typical bicarbonate buffer system consists of mixture : The typical bicarbonate buffer system consists of a mixture of carbonic acid and sodium bicarbonate in the same solution. What happens to the reaction that occurs when hydrochloric acid is added to the bicarbonate buffer system?

Example of mullerian mimicry : Which of the following is an example of Mullerian mimicry?

What is the hippocampus : What brain disorders or damages can happen if humans have no skull? How would the brain function without skull and bones? what is the hippocampus?

Sequence has experienced a spontaneous : Assume that the sequence below has experienced a spontaneous. mutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication.

Compare signaling by neurons to signaling by endocrine cells : Compare and contrast signaling by neurons to signaling by endocrine cells. What are the relative advantages of these two mechanisms for cellular communication ?

What are the pros and cons of the specific energy source : What are the pros and cons of the specific energy source you researched? Evaluate the pros and cons based on these criteria: Can your energy source stand alone to meet future energy needs?

Gene expression refers and about evolution : The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to. The term "gene expression" refers to the. Which of the following statements about evolution is true?

Blood groups are determined by three alleles : In humans, ABO blood groups are determined by three alleles: alleles IA and IB are codominant and both are dominant to the third allele i. MN blood groups are determined by two codominant alleles M and N.

User Account

All Pages