Sequence has experienced a spontaneous

Assignment Help Biology
Reference no: EM13527807

Assume that the sequence below has experienced a spontaneous
mutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication. Write the new sequence of the complementary strand as a result of this shift and identify the type of substitution (if any) for each base on new complementary strand compared to the original complementary strand.

Sequence (5’ TO 3’)
CGGTGTGACACTAGGTAGTCTAACGAGCTCACGGGCAGGGCTATATGTTGCAAAGTCGTAGGTCAC

Complementary sequence (3’ TO 5’)
GCCACACTGTGATCCATCAGATTGCTCGAGTGCCCGTCCGATATACAACGTTTCAGCATCCAGTG

Reference no: EM13527807

Questions Cloud

Research the kyoto agreement and the montreal protocol : Write a paragraph that research the Kyoto Agreement and the Montreal Protocol, what impacts
Typical bicarbonate buffer system consists of mixture : The typical bicarbonate buffer system consists of a mixture of carbonic acid and sodium bicarbonate in the same solution. What happens to the reaction that occurs when hydrochloric acid is added to the bicarbonate buffer system?
Example of mullerian mimicry : Which of the following is an example of Mullerian mimicry?
What is the hippocampus : What brain disorders or damages can happen if humans have no skull? How would the brain function without skull and bones? what is the hippocampus?
Sequence has experienced a spontaneous : Assume that the sequence below has experienced a spontaneous. mutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication.
Compare signaling by neurons to signaling by endocrine cells : Compare and contrast signaling by neurons to signaling by endocrine cells. What are the relative advantages of these two mechanisms for cellular communication ?
What are the pros and cons of the specific energy source : What are the pros and cons of the specific energy source you researched? Evaluate the pros and cons based on these criteria: Can your energy source stand alone to meet future energy needs?
Gene expression refers and about evolution : The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to. The term "gene expression" refers to the. Which of the following statements about evolution is true?
Blood groups are determined by three alleles : In humans, ABO blood groups are determined by three alleles: alleles IA and IB are codominant and both are dominant to the third allele i. MN blood groups are determined by two codominant alleles M and N.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd