User Account

All Pages

Reverse complement of database sequence

Assignment Help Biology
Reference no: EM133413663

Peform a BLASTN search manually to find high-scoring ungapped local alignments. Query: TTACTTGCGCA

Databasesequence: CCTACCGGCGCTACTTAGAG

Scoring scheme: match/mismatch = 5/-4

Use a drop-off threshold score of 12 for termination of extension. You can skip the alignment using the reverse complement of the database sequence (i.e., consider the Plus/Plus alignment only).

1. Report the score and alignment of the highest scoring local alignment, if any, when a wordsize of 5 is used.

2. Report the score and alignment of the highest scoring local alignment, if any, when a wordsize of 4 is used.

Reference no: EM133413663

Questions Cloud

Allied victory and the central powers defeat in november : Using Hart and the video materials, explain the three key factors that led to the Allied victory and the Central Powers' defeat in November 1918
How did they interact with their environments : How did they interact with their environments and the native inhabitants of the lands on which they settled
What role do race, caste, and social class play : What role, would you say, race, caste, and social class played in the society you grew up in? How might you compare this to the role it played in this unit
What do you think would have been the situation : What do you think would have been the situation if the US had actually taken over Cuba and made it a state or territory? How would that have impacted the course
Reverse complement of database sequence : Peform BLASTN search manually to find high-scoring ungapped local alignments. You can skip the alignment using the reverse complement of the database sequence
What were the circumstances surrounding the spanish american : What were the circumstances surrounding the Spanish American war? please discuss the causes as well as outcomes
Discuss important components of cancer cell biology : Discuss important components of cancer cell biology, along with the clinical manifestations of cancer, and include at least one paraneoplastic syndrome
What does johnson show us about gender and sexuality : What does Johnson show us about gender and sexuality in Gold Rush California and What in Johnson's essay surprised you? Did anything here change
How does this demonstrate the difference between : How does this demonstrate the difference between what neurons encode in these two areas ? Design an experiment of your own to distinguish between these two

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd