User Account

All Pages

Repetitions of the data argument

Assignment Help Basic Computer Science
Reference no: EM131252568

Design an iterative and a recursive function called replicate_iter and replicate_recur respectively which will receive two arguments: times which is the number of times to repeat and data which is the number or string to be repeated.

The function should return an array containing repetitions of the data argument. For instance, replicate_recur(3, 5) or replicate_iter(3,5) should return [5,5,5]. If the times argument is negative or zero, return an empty array. If the argument is invalid, raise a ValueError.

Reference no: EM131252568

Questions Cloud

Part of a security team at a large corporation : You are part of a security team at a large corporation. Recently, a colleague asked why there is a policy against using public wireless networks with their company laptops. You explain that hackers use software to steal and analyze network traffic..
How could you use an elevator speech in social media : How is networking in person different from utilizing Social Media? How could you use an elevator speech in social media? Why is effective communication essential?
Trust off the equilibrium path : Recall the trust game depicted in Figure. We argued that for δ ≥ 1/2  the following pair of strategies is a sub game perfect equilibrium.
Define descent direction and line search : Why is it important to keep a symmetric positive definite iteration matrix Bk while seeking a minimum of a smooth function φ(x)? Does Newton's method automatically guarantee this?
Repetitions of the data argument : The function should return an array containing repetitions of the data argument. For instance, replicate_recur(3, 5) or replicate_iter(3,5) should return [5,5,5]. If the times argument is negative or zero, return an empty array. If the argument is..
State the kkt conditions and explain their importance : What is a quasi-Newton method? Name three advantages that such a method may have over Newton's method.
More of the names on your list correspond : One or more of the names on your list correspond to the same IP address, but when you type those names into your web browser, you see different pages. Why would more than one name be assigned to a single address?
Evaluates gdds current status regarding each of challenges : Evaluates GDD's current status regarding each of these challenges; Explains each leadership challenge facing the 21 st century leader: adaptability, sustainability and innovation.
What themes and ideas exist among all of the sources : What themes and ideas exist among all of the sources you covered for this week (book, articles, films, etc.) - What are the most significant learning outcomes according to your group from these sources?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  The human resources server to the payroll server

The human resources server to the payroll server?

  Designing an inheritance between classes

Using an example from your work or daily life, describe an "is-a" relationship. Why is an "is-a" relationship important when designing an inheritance between classes? What are the differences between "is-a" and "has-a" relationship?

  Implement the event-driven simulation of a bank

For example, the input fi le shown in the left columns of the following table should produce the output shown in the right column.

  Determine whether the expression is balanced

Given a sequence consisting of parentheses, determine whether the expression is balanced

  Effectiveness of a buy-back contract

What will happen to the effectiveness of a buy-back contract if the manufacturer's forecast is higher than the retailer's forecast? How might a retailer use this to their advantage?

  Design process

You have recently started your own software design company. You discover that your local DMV is looking to build a system that will allow receptionists to check customers in quickly. They would like for the system to allow customers to self-check-in ..

  Explain in your own words what dhtml is

Explain in your own words what DHTML is. What are three important enabling technologies for standard-based DHTML?

  Create an entity-relationship diagram

For each ERD, identify reasonable entities and their relationships (one-to-one, one-to-many, or many-to-many) using the crow's foot notation among these entities.

  Draw a complete e-r diagram

Each club has one moderator, who might or might not be a faculty member. Draw a complete E-R diagram for this example. Include all constraints.

  Levels of application of preventive measures

Dr. Sultz presents three "levels of application of preventive measures" related to the prepathogenesis and pathogenesis of disease. For each level of prevention, cite and describe at least three specific measures

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Review an article from teradata student network

You are required to review an article from Teradata Student Network or a refereed journal that is relevant to concepts discussed in any ONE (1) of the chapters under review. You must integrate in the last paragraph of this report, how the findings fr..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd