User Account

All Pages

Provide the corresponding mrna sequence

Assignment Help Chemistry
Reference no: EM132030954

Given the following DNA template (non-coding) sequence:

3' - CCGTCTCCATCATGTTGTACATGCGGGCGCTGTGCGCGGGCCCGGCCCG - 5' 

a) Provide the corresponding mRNA sequence and label the 5' and 3' ends:

b) What are the first 3 amino acids coded by this gene?

Reference no: EM132030954

Questions Cloud

What is total you would end up paying to clear your balance : What is the total you would end up paying to clear your balance?
Aerobic and anaerobic glycolysis in terms of starting : What are the major differences between aerobic and anaerobic glycolysis in terms of starting substrate, products and amount of energy produced?
Mutation in its uracil dna glycosylase : Suppose a cell develops a mutation in its uracil DNA glycosylase. What aberrant nucleotide will accumulate in the DNA of this cell? What change in the DNA
Semi-conservative model of dna replication : Describe the key experiments that supported the semi-conservative model of DNA replication in E. coli.
Provide the corresponding mrna sequence : a) Provide the corresponding mRNA sequence and label the 5' and 3' ends: b) What are the first 3 amino acids coded by this gene?
What is the expected yield on this pool of loans : The coupon rate promised to investors on securities issued against a pool of loans is 6.5%. What is the expected yield on this pool of loans?
How to assemble a product or complete a procedure : Instruction sets are common technical documents for many disciplines and occupations. Employees read instructions to learn how to assemble a product.
What is the expected return on hello stock : What is the expected cash flow to Hello equity holders each year? What is the expected return on Hello stock?
Coupled role with a single function : The pentose phosphate cycle has an oxidative and a nonoxidative section and these are presented as both playing important metabolic roles

Reviews

Write a Review

Chemistry Questions & Answers

  What would be the volume of the gas

A certain quantity of a gas occupies 61.3 mL at 68 ?C. If the pressure remains constant, what would be the volume of the gas at 128 ?C?

  Write the mechanism for the acid-catalyzed reaction of amide

Write the mechanism for the acid-catalyzed reaction of an amide with a methanol to form an ester

  Explain the fundamental difference between singlet and

explain the fundamental difference between singlet and triplet state. from this fundamental difference explain why

  What is this temperature in kelvins

Neon, a gaseous element used in neon signs, has a melting point of -248.6 °C and a boiling point of -246.1 °C. Express these temperatures in kelvins.

  Explain the ionic compunds formed co+2

Write the formula for the ionic compunds formed between Co+2 and the simple ions formed by 1) cabon, 2)nitrogen, 3) oxygen and 4)fluorine.

  Explain the molar mass of a protein is from a measurement

The molar mass of a protein is determined from a measurement of the osmotic pressure. If 0.01 grams of the protein is dissolved in 1 ml. and osmotic pressure of 5 x 10-3 atm develops at a temperature of 310 K, what is the molar mass of the protein..

  Explain what is the molarity of co2 in water

The aqueous solubility of CO2 at 20 degrees Celsius and 1.00 atm is equivalent to 87.8 mL of CO2(g), measured at STP, per 100 mL of water. What is the Molarity of CO2, in water, that is at 20 degrees Celsius and saturated with air at 1.00 atm. The..

  Explain solution is made my mixing equal masses of methanol

A solution is made my mixing equal masses of methanol, CH4O and ethanol, C2H6O. Determine the mole fraction of each component to at least three significant figures.

  Define spontaneous and calculate the standard cell potential

Given the following two half-reactions, write the overall balanced reaction in the direction in which it is spontaneous and calculate the standard cell potential.

  Calculate the molality of a solution containing naphthalene

Question- Calculate the molality of a solution containing 16.5 g of naphthalene (C10H8) in 59.3g benzene (C6H6).

  Position of a waitress in a chinese restaurant

An American, a Russian and a Chinese applied for a position of a waitress in a Chinese restaurant in Houston.

  Determine the molarity of the koh solution

20ml of 0.15M H3PO4 is required to neutralize 40ml of a KOH solution. The molarity of the KOH solution is?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd