Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
1.A fruit fly with a gray body and red eyes (genotype BbPpgenotype bbpp) is mated with a fly having a black and purple eyes ().
a) Show diagrammatically a genetic cross between the two flies and the possible genotypes and phenotypes of F1. What ratio of offspring would you expect if the body-colour and eye-colour genes are on different chromosome (unlinked)?
b) When mating is actually carried out, most of the offspring look like the parents, but 3% have a gray body and purple eyes, and 3% have a black body and red eyes. Compare and discuss the observation with your answer in part (a).
2.The base sequence of the gene coding for a short polypeptide is 5'CTACGCTAGGCGATTGATCATC'3.
a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence
b) State the amino acid sequence of the polypeptide translated from this mRNA
c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
a. Is it reasonable to conclude that watching Oprah causes a decrease in cravings for fattening foods? Explain.
what is one way a health care professional may protect himself or herself from liability? are the liability issues the
What is the free energy of the reactants (QR + H2O)? Enter your answer below in units of kJ/mol. Do not include units in your response
HA535-1-you will be locating and using evidence to support a specific health-based concern or topic. Using the resources available to you,
Cloning involves replacing a cell's nucleus with a nucleus from a donor cell. Describe the process of cloning and how its' process relates
Smallpox has a rich history-from prompting the first vaccine to potential use as a bioterrorism agent.
Draw the molecule by placing atoms on the grid and connecting them with bonds. Include all lone pairs of electrons.
A controversial issue, closely related to cloning, that has caused a lot of debate is the use of embryonic stem cells.
What are the benefits of RNAseq over DNA microarrays for expression profiling?
In rumbunnies, sober is an autosomal recessive gene in which the rumbunnies are unable to utilize alcohol. Mating success in rumbunnies is a function of alcohol consumption so that sober individuals have only 75% as many offspring as normal rumbun..
When proteins that form non-specific channels are inserted into the cell membrane of an aerobic bacteria you will see a rapid decrease in the ability.
Compare and contrast the anatomy, functions, and mechanism of action of the three types of musculoskeletal systems typical of Animals and indicate which type of system each of your species possesses?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd