Possible genotypes and phenotypes of f1

Assignment Help Biology
Reference no: EM132604785

1.A fruit fly with a gray body and red eyes (genotype BbPpgenotype bbpp) is mated with a fly having a black and purple eyes ().

a) Show diagrammatically a genetic cross between the two flies and the possible genotypes and phenotypes of F1. What ratio of offspring would you expect if the body-colour and eye-colour genes are on different chromosome (unlinked)?

b) When mating is actually carried out, most of the offspring look like the parents, but 3% have a gray body and purple eyes, and 3% have a black body and red eyes. Compare and discuss the observation with your answer in part (a).

2.The base sequence of the gene coding for a short polypeptide is 5'CTACGCTAGGCGATTGATCATC'3.

a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence

b) State the amino acid sequence of the polypeptide translated from this mRNA

c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.

Reference no: EM132604785

Questions Cloud

Demonstrate what is total stockholders equity : What is total stockholders' equity given the following information? Which situation below might raise concerns about a company's quality of earnings?
Research the approximate size of the highest-level consumer : 1) Research the approximate size of the highest-level consumer in your ecosystem.
Research genetic diseases : We are going to discuss about the nucleic acids, RNA and DNA. They are responsible for our genes and as a result
Describe the process of cloning : ribe the process of cloning and how its' process relates to the properties and functionalities of the plasma cell membrane.
Possible genotypes and phenotypes of f1 : 1.A fruit fly with a gray body and red eyes (genotype BbPpgenotype bbpp) is mated with a fly having a black and purple eyes ().
Information below about sexual disorders : What is a good response to the information below about Sexual Disorders?
Pcr run using a new set of primers : After a PCR run using a new set of primers, upon electrophoresis, your gel shows no amplification bands at all.
Specific approaches for designing enzymes : In case of biofuels, discuss two specific approaches for designing enzymes which can improve biofuel production.
Should koho accept the order : Should Koho accept the order? The company's annual capacity is 10,000 units and they are currently operating at 95% of capacity.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd