Polypeptide synthesized by eukaryotic ribosomes

Assignment Help Biology
Reference no: EM132932533

1. If a molecule of mRNA has the following nucleotide base sequences, what will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes? Remember, transcription begins with the start codon AUG.

a. AUGGGGAUACGCUACCCC

b. CCGUACAUGCUAAUCCCU

2. Give the mRNA and then the amino acid sequence for the following base sequence in DNA:

TACGGGGGGAGAGGGGGAGGGGGA

3. What DNA nucleotides code for the codon UGU? Identify a base pair substitution that would produce a silent mutation at this codon. Identify a base pair substitution that would result in a missense mutation at this codon. Identify a base-pair substitution that would result in a nonsense mutation at this codon.

Reference no: EM132932533

Questions Cloud

Access diagnostic and statistical manual of mental disorders : Access the Diagnostic and Statistical Manual of Mental Disorders, to learn about Bipolar Disorder and Related Disorders, Depressive Disorder, Anxiety Disorder
Artificial selection of organisms : Describe the difference between artificial selection of organisms and genetically modifying organisms.
What contributions provide these means of communication : Indicate what contributions provide these means of communication that are useful for the practice of Social Work in the area of ??mental health.
Describe the self-enhancement and self-verification motives : Describe the self-enhancement and self-verification motives for self-esteem. Evaluate the posts/pages you see through the lens of self-presentation.
Polypeptide synthesized by eukaryotic ribosomes : What will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes?
Describe the three elements of a persuasive appeal : Describe the three elements of a persuasive appeal, and give two examples of each element that influence persuasiveness. Have you ever been persuaded
What is the self-validation hypothesis : What aspects about our thoughts, besides the valence and number of thoughts we have on a topic, influence whether or not we are persuaded by them?
Body metabolizes carbohydrates and protein in fed state : Explain how the body metabolizes carbohydrates and protein in the fed state. Explain how the body metabolizes carbohydrates and fat in the fed state.
What is distinct compliance strategies : Compliance strategies, the "that's not all" and "door in the face" techniques share a common mechanism. What is it, and how does it work in each case?

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd