Perform two-dimensional gel electrophoresis

Assignment Help Biology
Reference no: EM13973737

1. The individual read sizes generated by next-generation sequencing (NGS) are typically between 100 - 1000 bp in length, depending on the specific system used. However, NGS is able to provide full-genome sequences for complex organisms. It is able to do this via producing ______________ from the individual reads.
-ddNTPs
-cDNA
-emulsified droplets
-contigs
-phosphodiester bonds

2. The constitutive promoter that you placed upstream of your gene is expressing too much of the gene. Which of the following can you use to have it express less?
-Make the promoter weaker by changing the sequences of the -10 and -35 regions to their reverse complements
-Make the promoter stronger by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences
-Make the promoter weaker by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences
-Make the promoter stronger by changing the sequences of the -10 and -35 regions to less closely match the consensus sequences
-Make the promoter weaker by changing the sequences of the -10 and -35 regions to less closely match the consensus sequences

3. You're writing a grant proposal that involves transferring foreign DNA into five different systems. For which of the following would you use the term "transform" for this introduction of foreign DNA?
-Escherichia coli
-Saccharomyces cerevisiae
-Cavendish banana plants
-Drosophila melanogaster
-Human cell lines

4. Before a eukaryotic gene can be properly expressed in a prokaryotic system, which of the following must be removed to leave only the coding sequence?
-Amplicons
-Electrons
-Exons
-Introns
-Decepticons

5. RFLP analysis is useful for identifying spatiotemporal migration patterns in outbreak investigations because the natural evolution rate of the organisms can cause _____________ to occur, which can destroy existing or create new ____________.
-codon bias;
-co-repressor molecules; inducible gene promoters
-mutations; restriction enzyme sites
-RNA interference (RNAi); gene silencing
-transformations; antibiotic resistance genes

6. In an SBOL Visual representation of the lac operon, which of the following would represent lacO?

2212_SBOL Visual representation.png

 

7. The 5' overhang on your vector is GATC. Which of the following restriction enzymes should you use to cut your insert so it is compatible?
-AluI
-BamHI
-EcoRI
-HindIII
-NotI

8. Which of the following would not eliminate the inducible nature of the lac promoter?
-Eliminating the lacO1 operator site
-Eliminating the lacO3 operator site
-Eliminating the lacI gene which encodes the lac repressor
-Eliminating the lacZ gene which encodes β-galactosidase
-Eliminating the ability of the lacI monomers to form a tetramer

9. In order to perform a successful transformation, for which of the following would you most likely have to use electroporation or chemical competence?
-Bacillus subtilis
-Escherichia coli
-Haemophilusinfluenzae
-Neisseria spp.
-Streptococcus pneumoniae

10. Which of the following would be the easiest method to identify if a bacterial clone's antibiotic resistance gene has been disrupted?
-Blue-white screening
-Functional complementation
-Library screening
-Replica plating
-TA cloning

11. You've used synthetic biology to design a new biological system that could help with the bioremediation of oil spills. Altogether, the genetic networks you designed total 150 kbp. In order to transform your synthetic network into Escherichia coli, which of the following vector systems should you use?
-Bacterial artificial chromosome (BAC)
-Bacteriophage λ
-Cosmid
-Plasmid
-Yeast artificial chromosome (YAC)

12. A suicide vector is not maintained as a plasmid in the target host but instead transforms the host by transferring its insert into the host genome (typically the chromosome). This transfer occurs via what mechanism?
-Baculovirus
-Co-immunoprecipitation
-Homologous recombination
-Origin of replication
-Sticky ends

13. Which of the following is not required to perform two-dimensional gel electrophoresis (2DGE)?
-Breaking the peptide bonds between amino acids
-Denaturing the higher-order structure of the proteins
-Isoelectric focusing
-Separation based on pI and molecular mass
-Use of a detergent, such as sodium dodecyl sulfate (SDS)

14. The DNA melting curve for the PCR primer 5'- ATGCCCGAATTGCCTAGTAG -3' is shown in blue. Which of the following is the sequence for the PCR primer represented in red?

1797_SBOL Visual representation1.png

-5'- ATGCCCTAGTAGCCGAATTG -3'
-5'- CTACTAGGCAATTCGGGCAT -3'
-5'- TGAACCGTATGCCCTGCGAG -3'
-5'- CGGTACATGGCCATCATTAA -3'
-5'- ATGAGTACTTAGCCAGTGAA -3'

15. Pluripotent embryonic stem cells can be induced to differentiate into which of the following types of cells?
-Epithelial cells
-Fibroblasts
-Hepatocytes
-Lymphocytes
-All of the above

16. Which of the following techniques is not based on the basic principle of hybridization between complementary nucleotides?
-DNA microarrays
-Northern blotting
-RNA microarrays
-FISH
-Western blotting

17. Which of the following techniques relies on the fluorescent emission of one molecule being absorbed by another, which in turn produces a second fluorescent emission?
-Chromatin immunoprecipitation (ChIP)
-Fluorescence resonance energy transfer (FRET)
-Nuclear magnetic resonance (NMR)
-X-ray crystallography
-Yeast two-hybrid system

18. During PCR, an annealing temperature much lower than the Tm of the primers would most likely result in which of the following problems?
- Lack of denaturation
- Secondary structure formation of the primers
- No amplification
- Nonspecific amplification
-Insufficient extension

19. The following sequences were obtained by Sanger sequencing. What is the length of the properly generated contig?

TTAGATGCATAGAAATGA

CAGCCCTGGCACATGAAA

ATGAAATGGACATGTAGA

AAATGAGTGATCCAGCCC

-32bp
-48bp
-54bp
-60bp
-72bp

20. Which of the following is not necessarily a desired feature of a molecular diagnostic assay?
-Cost effectiveness
-Efficiency
-Nucleic acid detection
-Sensitivity
-Specificity

Reference no: EM13973737

Questions Cloud

Calculate the magnitude of the magnetic field at given point : Two straight parallel wires carry currents in opposite directions as shown in the figure. One of the wires carries a current of I2 = 10.6 A. Calculate the magnitude of the magnetic field at point A
Finding faith and direction in life through myths : You make explicit the relationships that you have inferred among separate sources, make judgments, draw conclusions and critique individual sources to determine the relationship among them
How much work does diego do : Diego, Mighty Sled Dog of the North, pulls a 45.0 Kg sled across level snow with a force of 225 N on a rope that is 35.0 degree above the horizontal. Make a drawing of the situation. This is Diego; use him in your drawing.
Value for the magnitude of the magnetic field : Two straight wires separated by a very small distance run parallel to each other, one carrying a current of 3.0A to the right and the other carrying a current of 4.1A to the left. Give the approximate value for the magnitude of the magnetic field a..
Perform two-dimensional gel electrophoresis : In order to perform a successful transformation, for which of the following would you most likely have to use electroporation or chemical competence - perform two-dimensional gel electrophoresis
What refers to both types of problems : What refers to both types of problems and disorders that would be found in a clinic or hospital and to be the activities connected with assessment and treatment
Consumers of the science of psychopathology : 1. Consumers of the science of psychopathology. That is that they keep up with recent developments which benefits their patients.  2. Evaluators of own assessments or treatment procedures to see whether they work.
What is the distance of the farther object : Two students in a physics laboratory each have a concave mirror with the same radius of curvature, 42.0 cm. Each student places an object in front of a mirror. What is the distance of the farther object
Determine the location of the image of the object : Use the three principal rays to determine the location of the image of the object produced by lens 1. Treat the image produced by lens 1 as an object for lens 2. Use the thee principal rays to determine the location of the image of this produced by..

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd