Percent of gc content for each of primers

Assignment Help Biology
Reference no: EM131409033

**When answering, if you could provide a resource to backup your answer please**

When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.

Table 4

Primer 1: TAGCTCAAAGGGTACCTCAG

Primer 2: GATTGGAAGGAACTTCTA

Reference no: EM131409033

Questions Cloud

Discuss: identify and beliefs of martin luther : Discuss: Atlantic slave trade. Identify middle passage(one sentence)/ Discuss: role Women's in Africa & role Cassava's (veg.) . Scientific revolution. Discuss & Identify: The scientists & Universities, Discoveries/ beliefs/ theory. Last. Discuss: ..
Find the spectrum of the modulated binary pam signal : A binary PAM signal is generated by exciting a raised-cosine roll-off filter with a 50% roll-off factor and then DSB-SC amplitude modulating it on a sinusoidal carrier, as illustrated in Figure P-10.17. The bit rate is 2400 bps.
Determine the least squares regression line and calculate r : Determine the least-squares regression line and calculate r.- What proportion of the variability in sock shipments is explained by the regression equation?
Aristotle paradoxical description of soul friendship : Close friendship requires an individual to possess a greater range of qualities than just a fulsome capacity for reciprocal goodwill. It requires a proper sort of self-regard-the kind that allows the individual to get over themselves; and a wider ..
Percent of gc content for each of primers : When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.
Whether the true coefficient of correlation could be zero : Testing the null hypothesis that the slope of the true regression line equals zero is equivalent to testing whether the true coefficient of correlation could be zero. Why?
Determine the residual isi at the output of the equalizer : Also, determine the residual ISI at the output of the equalizer for the optimum tap coefficients.
What do findings tell you about financial health of company : What do the findings tell you about the financial health of the company? How does your selected company compare to the industry?
Spokane falls in spokane washington : A 4-6 page APA format paper on the Spokane Falls in Spokane Washington. This is for an Anthropology 100 class. Please see assignment instructions below.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd