User Account

All Pages

Percent of gc content for each of primers

Assignment Help Biology
Reference no: EM131409033

**When answering, if you could provide a resource to backup your answer please**

When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.

Table 4

Primer 1: TAGCTCAAAGGGTACCTCAG

Primer 2: GATTGGAAGGAACTTCTA

Reference no: EM131409033

Questions Cloud

Discuss: identify and beliefs of martin luther : Discuss: Atlantic slave trade. Identify middle passage(one sentence)/ Discuss: role Women's in Africa & role Cassava's (veg.) . Scientific revolution. Discuss & Identify: The scientists & Universities, Discoveries/ beliefs/ theory. Last. Discuss: ..
Find the spectrum of the modulated binary pam signal : A binary PAM signal is generated by exciting a raised-cosine roll-off filter with a 50% roll-off factor and then DSB-SC amplitude modulating it on a sinusoidal carrier, as illustrated in Figure P-10.17. The bit rate is 2400 bps.
Determine the least squares regression line and calculate r : Determine the least-squares regression line and calculate r.- What proportion of the variability in sock shipments is explained by the regression equation?
Aristotle paradoxical description of soul friendship : Close friendship requires an individual to possess a greater range of qualities than just a fulsome capacity for reciprocal goodwill. It requires a proper sort of self-regard-the kind that allows the individual to get over themselves; and a wider ..
Percent of gc content for each of primers : When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.
Whether the true coefficient of correlation could be zero : Testing the null hypothesis that the slope of the true regression line equals zero is equivalent to testing whether the true coefficient of correlation could be zero. Why?
Determine the residual isi at the output of the equalizer : Also, determine the residual ISI at the output of the equalizer for the optimum tap coefficients.
What do findings tell you about financial health of company : What do the findings tell you about the financial health of the company? How does your selected company compare to the industry?
Spokane falls in spokane washington : A 4-6 page APA format paper on the Spokane Falls in Spokane Washington. This is for an Anthropology 100 class. Please see assignment instructions below.

Reviews

Write a Review

Biology Questions & Answers

  Error rate of transcription

The error rate of transcription is much higher than the error rate of replication. Explain why this is not a problem for cells?

  Consider the solubility rules

Consider the solubility rules and identify all of the spectator ions when the following chemicals react: A) lead (II) nitrate and ammonium chloride B) Barium bromide and potassium carbonate. You must show all work (equations) clearly and in detail..

  Probability of a cross resulting in white offspring

What is the probability of a cross resulting in white offspring when two heterozygous purple pea plants (e.g. Pp x Pp) are bred? What is the genotype for this offspring?

  Common sources of campylobacter jejuni infection

What was the likely source of infection in this case study? What are the common sources of Campylobacter jejuni infection that lead to human infection

  Relationship between voluntary and involuntary reflex

Sometimes when it is difficult to initiate a knee-jerk reflex by tapping the patellar tendon, a patient will be asked to voluntary make a fist. Than the reflex will be easily evoked. What does this illustrate about the relationship between volunta..

  Describe the multiple levels of cdk regulation

Describe the multiple levels of cdk regulation and the significance of regulated cdks in the regulation of the cell cycle.

  Illustrates the concept of species of trilobite

A species of trilobite was found in the fossil record. At its first appearance, it is similar to an ancestor species but differs from the ancestor in several key characteristics.

  Different types of bacterial toxins

Describe 5 different (specific) types of bacterial toxins, how theyare regulated, mode of action, and anysimilarities/dissimilarities

  Infectious agent solely composed of rna

A _______ is an infectious agent solely composed of RNA, whereas a_________ is an infectious

  Where does the label appear in mevalonate

When palmitate labeled with 14C at every odd-numbered carbon is added to a liver homogenate, where does the label appear in mevalonate?

  What does glycerol extraction do to muscle

What does glycerol extraction do to muscle?

  Oxidative phosphorylation would slow down in mitochondria

throughput a heart attack, blood flowing to the heart muscle is interrupted by blockage of a coronary artery. How would you expect the metabolism in the heart to change?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd