Networks are fundamental

Assignment Help Basic Computer Science
Reference no: EM13137671

Description: Networks  are  fundamental  to  every  aspect  of  our  society.  Designing  a  network  that  
is  both  adequate  to  current  and  future  needs  is  important.  In  this  assignment,  you  are  asked  to  
design a network according to a specification.  
  
Organisation Structure: 
The  organisation  in  this  scenario  is  concerned  with  scientific  research.  It  is  composed  of  the  
following divisions.  
  
a) Research Scientists (50 staff)  
b) Commerce and Marketing (20 staff)  
c) Academic staff and University Student Interns (80 staff)  
d) Management (20 staff)  
e) IT staff (5 staff)  
f) Admin (10 staff)  
g) 
 Laboratory Scientists (20 staff)  
  
The  premises  are  located  on  the  edge  of  a  well  known  university  campus.  The  laboratory  is  located  
on  campus.  The  organisation  is  physically  structured  as  follows.  Research  scientists  and  Commerce  
and  Marketing  are  located  on  the  top  floor  of  the  building.  Academic  staff  and  Uni.  Students  
are  
located  on  the  second  floor  along  with  Management.  IT  staff  and  Admin  occupy  the  ground  floor.  
The laboratory is located within the campus on the ground floor of the science building.   
  
The  requirement  is  to  build  an  efficient  network  to  meet  the  needs  of  the  organisation  and  for  its  
future 
 growth.  
  
The IT specifications for each unit are these:  
a) Research Scientists - 40 workstations + access to research database  
b) Commerce and Marketing - 10 workstations + access to company marketing database  
c) Academic staff and University Student Interns - 60 workstations   
d) Management - 10 workstations + access to company business database  
e) IT staff - 5 workstations + access to all company IT assets  
f) Admin - 5 workstations + access to all company databases via software to generate reports  
g) Laboratory Scientists - 10 workstations + access to research database (e.g. same as group a)  
  
As  each  department  has  fewer  office  workstations  compared  with  staff,  a  requirement  for  offsite  
access is mandatory. The campus has existing IT infrastructure which you will have to utilise in order  
to connect to the main office.  

Your task: Using  the  information  provided  about  the  organisation,  design  a  network  layout  to  
maximise  efficiency  and  to  allow  both  onsite  and  offsite  access  to  the  resources  by  employees.  You  
will  generate  a  network  layout  using  a  tool  such  as  'Packet  Tracer'.  It  is  important  to  give  labels  to  
your  interfaces,  both  name 
  and  IP,  one  such  example  of  labelling  is  displayed  in  the  following diagram

Reference no: EM13137671

Questions Cloud

Early extinguishment of debt : A company accomplished an early extinguishment of debt, and the auditors believe that literal application of SFAS No. 98 would cause recognition of a loss that would materially distort the financial statements and cause them to be misleading.
Explain longitudinal versus transverse vibrations in a bar : Longitudinal versus Transverse Vibrations in a bar, A 48 inch long by 2 inch diameter round steel rod (E=30e6 psi, density=0.28 lb/in3) is fixed at one end and free at the other. If the rod is struck transversely so that there is both a longitudin..
Find lifetimes cancer bearing mice-kolmogorov-smirnov test : Use the Kolmogorov-Smirnov test with significance level 0.05 to decide whether the following lifetimes (in days) of a sample of cancer bearing mice.
Commission on national response plan : Does the 9-11 Commission Report require significant changes in the National Response Plan with stronger vertical and horizontal integration between Federal, State, and local disaster response plans?
Networks are fundamental : Networks  are  fundamental  to  every  aspect  of  our  society.  Designing  a  network  that  is  both  adequate  to  current  and  future  needs  is  important.
Composing business messages : When composing business messages, how can you be yourself and project your company's image at the same time?
Describe a simulation to estimate the probability : Describe a simulation to estimate the probability of answering at least four of the ten questions correctly. carry out three repititons. estimate the probability
Homeland security and policies : Is it true that bureaucrats capitalized on the tragedies of 9/11 and Hurricane Katrina to squeeze through (policy changes) in the guise of homeland security.
What a business or government agency would need to consider : write an essay in which you evaluate what a business or government agency would need to consider before transferring a hardy but non indigenous species to another country.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Create an incident-response policy

Create an incident-response policy that covers the development of incident-response team, disaster-recovery processes, and business-continuity planning.

  List and describe three guidelines for sound policy

List and describe briefly the three guidelines for sound policy, as stated by Bergeron and Bérubé. Are policies different from standards? In what way? Are policies different from procedures? In what way?

  Explain kind of system real-time statistics

Permits customers to see real-time statistics like views and click-throughs about their current banner ads. Which kind of system will most efficiently give a solution.

  Distinguish between caching and buffering

Distinguish between caching and buffering The failure model defines the ways in which failure may occur in order to provide an understanding of the effects of failure. Give one type of failure with a brief description of the failure

  What rc key value leave state vector during initialization

What RC4 key value will leave state vector, S unchanged during initialization? That is after the initial permutation of S, the entries of S will be equal to the values.

  Explain one technological device

Explain one technological device in 350 to 700 words. Include the following:When did it come (or will it potentially come) into existence? What scientific or technological reasoning explains how this potential will be (or can be) be reached in t..

  Why computer literacy has become fourth fundamental skill

Explain whether today, computer literacy (knowledge of how to properly use computer and its software applications) has become fourth basic skill.

  Study evidence for defence in law firm

You are engaged by law firm to study evidence for the defence. You uncover evidence that doesn't help your client's case but was not discovered by the prosecution.

  How spki be augmented to support policy

Consider a policy that, for reasons of separation of duties, does not allow an entity to exercise the rights it may grant (delegate) to others. How could SPKI be augmented to support such a policy?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Steps to follow to verify local police department-s findings

Your computer investigation firm has been hired to verify the local police department's findings on a current case. What do you need to ask the police investigator for, and what procedures should you follow?

  Advantages and disadvantages of asymmetric or symmetric key

The Institute has collaborated with XYZ inc. for research on genetics. Information should be kept top secret at any cost. At ABC Institute, researchers are not sure about kind of key.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd