Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Description: Networks are fundamental to every aspect of our society. Designing a network that is both adequate to current and future needs is important. In this assignment, you are asked to design a network according to a specification. Organisation Structure: The organisation in this scenario is concerned with scientific research. It is composed of the following divisions. a) Research Scientists (50 staff) b) Commerce and Marketing (20 staff) c) Academic staff and University Student Interns (80 staff) d) Management (20 staff) e) IT staff (5 staff) f) Admin (10 staff) g) Laboratory Scientists (20 staff) The premises are located on the edge of a well known university campus. The laboratory is located on campus. The organisation is physically structured as follows. Research scientists and Commerce and Marketing are located on the top floor of the building. Academic staff and Uni. Students are located on the second floor along with Management. IT staff and Admin occupy the ground floor. The laboratory is located within the campus on the ground floor of the science building. The requirement is to build an efficient network to meet the needs of the organisation and for its future growth. The IT specifications for each unit are these: a) Research Scientists - 40 workstations + access to research database b) Commerce and Marketing - 10 workstations + access to company marketing database c) Academic staff and University Student Interns - 60 workstations d) Management - 10 workstations + access to company business database e) IT staff - 5 workstations + access to all company IT assets f) Admin - 5 workstations + access to all company databases via software to generate reports g) Laboratory Scientists - 10 workstations + access to research database (e.g. same as group a) As each department has fewer office workstations compared with staff, a requirement for offsite access is mandatory. The campus has existing IT infrastructure which you will have to utilise in order to connect to the main office. Your task: Using the information provided about the organisation, design a network layout to maximise efficiency and to allow both onsite and offsite access to the resources by employees. You will generate a network layout using a tool such as 'Packet Tracer'. It is important to give labels to your interfaces, both name and IP, one such example of labelling is displayed in the following diagram
Create an incident-response policy that covers the development of incident-response team, disaster-recovery processes, and business-continuity planning.
List and describe briefly the three guidelines for sound policy, as stated by Bergeron and Bérubé. Are policies different from standards? In what way? Are policies different from procedures? In what way?
Permits customers to see real-time statistics like views and click-throughs about their current banner ads. Which kind of system will most efficiently give a solution.
Distinguish between caching and buffering The failure model defines the ways in which failure may occur in order to provide an understanding of the effects of failure. Give one type of failure with a brief description of the failure
What RC4 key value will leave state vector, S unchanged during initialization? That is after the initial permutation of S, the entries of S will be equal to the values.
Explain one technological device in 350 to 700 words. Include the following:When did it come (or will it potentially come) into existence? What scientific or technological reasoning explains how this potential will be (or can be) be reached in t..
Explain whether today, computer literacy (knowledge of how to properly use computer and its software applications) has become fourth basic skill.
You are engaged by law firm to study evidence for the defence. You uncover evidence that doesn't help your client's case but was not discovered by the prosecution.
Consider a policy that, for reasons of separation of duties, does not allow an entity to exercise the rights it may grant (delegate) to others. How could SPKI be augmented to support such a policy?
Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.
Your computer investigation firm has been hired to verify the local police department's findings on a current case. What do you need to ask the police investigator for, and what procedures should you follow?
The Institute has collaborated with XYZ inc. for research on genetics. Information should be kept top secret at any cost. At ABC Institute, researchers are not sure about kind of key.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd