Lots of naïve cd4 and cd8 t cells

Assignment Help Business Management
Reference no: EM132553044

The body produces lots and lots of naïve CD4 and CD8 T cells that spend most of their time circulating the body doing nothing but each having the potential to assist in an immune response to an antigen. To become an effector cell, T cells need instruction, and the best instructor is the dendritic cell. Imagine the following scenario - you have fallen over and scratched your knee, which has allowed some bacteria enter the skin. Starting from this first exposure to the bacteria, detail all the cell types, lymphoid organs migration, interactions and responses that will occur in generating an adaptive CD4 T cell response.

Reference no: EM132553044

Questions Cloud

Describe all the various interactions that a b cell : Describe all the various interactions that a B cell will have during the generation of a B cell response and the reason or need for each of these.
Determine yux monthly break-even point in units : Assuming fixed costs and net sales are spread evenly throughout the year, determine YUX's monthly break-even point in units and dollars.
SITXMGT002 Establish and conduct business relationships : SITXMGT002 Establish and conduct business relationships Assignment Help and Solution, Mastery Institute Australia - Assessment Writing Service
Overall humoral immunity to pathogens : Antibodies come in many different isotypes in which they differ in structure, distribution in the body, and their effector mechanisms.
Lots of naïve cd4 and cd8 t cells : The body produces lots and lots of naïve CD4 and CD8 T cells that spend most of their time circulating the body doing nothing but each having the potential
Find what was the standard materials quantity per unit : Crede Manufacturing Company uses a standard, Find what was the standard materials quantity per unit? (Round answer to 2 decimal places, e.g. 5.17.)
KF7031 Wireless Networks and Security Assignment : KF7031 Wireless Networks and Security Assignment Help and Solution - Northumbria University - Assessment Writing Service - What is Multipath in RF transmission
Calculate the unit cost of each of the three speedboat model : Calculate the unit cost of each of the three speedboat models using the proposed activity-based costing system of allocating overhead.
Determining the type of mutation : If you don't have a partner use this sequence to answer #1: TACTAACTATTATAGGCCGTATGGATC Have your partner introduce a point mutation

Reviews

Write a Review

Business Management Questions & Answers

  Leadership styles of hitler and stalincompare and contrast

leadership styles of hitler and stalincompare and contrast the leadership styles and traits of these two leaders. why

  Gay and lesbian issues in the workplace

Examine the presentation on gay and lesbian issues in the workplace.

  Compare difference in contingency and situational leadership

Compare and contrast the differences in contingency and situational leadership. Then, determine the key influences they each have on organizational performance.

  Home country-based pay and headquarters-based pay

Evaluate the following methods for establishing base pay in international assignments: home country-based pay, headquarters-based pay,

  Island countries called dolorium and contente

Consider two neighboring island countries called Dolorium and Contente. They each have 4 million labor hours available per week that they can use

  Concept of object oriented programming

What is the significance of the concept of inheritance within the concept of object oriented programming?

  How did management handle the crisis

1. What was the outcome of the BP oil spill in April 20th 2010 2. How did management handle the crisis?

  Significance of vision in transforming organizations

What is the significance of Vision in transforming organizations? Identify three (3) common errors to organizational change efforts.

  Major determinants of price elasticity of demand

What are the major determinants of price elasticity of demand? Use those determinants and your own reasoning in judging whether demand

  Company market segment assignment

Submit the Company's Market Segment assignment. In this assignment, you must identify, describe, and thoroughly analyze the market segments your company has chosen to compete in and support of the coca-cola company.

  The concept called managing the product life cycle

Describe this comment which is referring to the concept called managing the product life cycle: Sometimes demand patterns should be

  Explain countries with lower standards of living

Explain Countries with lower standards of living are considered to be emerging or developing nations and What factors prevent developing countries from becoming developed

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd