Local telephone calls and long distance telephone calls

Assignment Help Basic Computer Science
Reference no: EM1364663

It's discussion Questions.

1. Are LANs a stable technology or are they changing just as quickly as other forms of communication technologies?

2. Should software licenses be dropped completely?

3.Will the distinction between local telephone calls and long distance telephone calls ever disappear? What may cause this to happen?

Reference no: EM1364663

Questions Cloud

Budget preparation of health care organizations : How do imperfections in coding affect the budget preparation of health care organizations? How might it also affect. The contracts between professional billers and coders and health care organizations?
Advantage of deterministic local area network protocol : State the primary advantage of a deterministic local area network protocol over a nondeterministic local area network protocol.Give a real-life example of this advantage.
Description of income tax : Suppose that Helen's marginal income tax rate is 28 percent. Compare her after-tax income and her group medical costs under three scenarios:
What is vertical analysis : What is vertical analysis? When would you use vertical analysis instead of horizontal? Do companies use one or the other? Please explain. What about industry averages? How do people use industry averages for comparative analysis?
Local telephone calls and long distance telephone calls : Will the distinction between local telephone calls and long distance telephone calls ever disappear? What may cause this to happen?
Show internal factor evaluation matrix for mcdonalds : Prepare an IFE Matrix for McDonalds. Summarize your observations, including strategic implications as a result of the IFE and Financial Ratio analysis.
Ownership for an aggressive entrepreneurial firm : What is the most appropriate form of ownership for an aggressive entrepreneurial firm?
Explaining the challenges of hr professionals : Explore and explain the challenges HR professionals face within their own organizations to meet goals to become a strategic partner, an employee advocate for benefits, and a moral compass to instill corporate integrity in its leaders.
Pipeline diagram for processor which has no forwarding : If the processor has no forwarding, how many cycles will one loop iteration take? show a pipeline diagram to support your answer.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Design robot that can perform any function or activity

Design a robot that can perform any function or activity you choose from an automatic laundry robot to a customer service robot.

  Explaining use of information technologies to act ethically

When it comes to use of information technologies, it is frequently difficult to find out how to act ethically. Consider some of your own use of information technologies.

  Differentiating unix and window traceroute

Compare and contrast differences between Unix (or Linux) and Window Traceroute. All codes for each ICMP error message are not completely listed and explained.

  Calculate present value of future earnings

Why do we need to calculate the present value of future earnings? A company can invest $100,000 to develop a new system, or it can put that amount into a second best alternative investment getting 10 percent.

  Probability-first game joe enters is fourth game of season

Joe Coledge is the third-string quarterback for the University of Alatoona. What is the probability that the first game Joe enters is the fourth game of the season?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Find out product stream temperature and volume

Find out the product stream temperature and volume required to carry out reaction in a CSTR at 50 % conversion in adiabatic mode of operation.

  Corporate goal for scr new training activity

We require corporate goal for SCR which refers to new training activity. Create a draft to show Jesse. Draft project scope statement for TIMS system

  Explaining it acquisition issued request for proposal

A federal agency that does not use IT acquisition best practices issued a request for proposal that requires the contractor selected to use such practices, including certification at CMMI Level 3 or above.

  Design a suitable source document for ads

Terrier News is a monthly newsletter devoted to various breeds of terriers and topics of interest to terrier owners and breeders. Design a suitable source document for ads that are telephoned or mailed in.

  Explaining cash-drawer management concept

Explain in scholarly detail cash-drawer management concept and its relationship to departmental Budget vs. Actual control process.

  Write difference between logical and physical modeling

What is the difference between logical and physical modeling? Give three reasons why logical models are superior for structuring business requirements.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd