User Account

All Pages

List the complementary dna sequence

Assignment Help Biology
Reference no: EM132534411

Using the codon wheel and the following mRNA sequence below, answer the following questions:

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC

1. List the DNA strand sequence from which the mRNA was transcribed:

2. List the complementary DNA sequence to the above DNA strand:

3. List the tRNA sequence that is complementary to the mRNA strand above:

4. Using the codon wheel, list the amino acid sequence of the protein coded for by the original mRNA sequence:

5.

a) What would be the effect of changing base 4 to a G?

b) What would the effect be if base 6 was changed to a G? c) What would be the effect of changed base 16 to a U?

d) What would happen if base 7 was deleted?

e) What would the new amino acid sequence be?

Reference no: EM132534411

Questions Cloud

Major branches of the tree of life : Summarize the similarities and differences between the major branches of the tree of life, highlighting the major groups in each domain and kingdom.
Discuss impact of each of the categories on buying behavior : The family is the most important consumer,Name two family categorizations and discuss the impact of each of the categories on buying behavior.
Maintains oxygen-carrying homeostasis : The body maintains oxygen-carrying homeostasis at high altitudes with which response?
Prepare budget that is useful for making decisions : The time span involved in life-cycle budgeting makes it too difficult to prepare budget that is useful for making decisions. Do you agree? Explain your answer.
List the complementary dna sequence : Using the codon wheel and the following mRNA sequence below, answer the following questions:
What are some factors that customers look for in restaurant : Your client has a restaurant in the province. Their main customers are locals from that province. What are some factors that customers look for in a restaurant?
Describe how the structure of the tissue relates : Can someone help me describe how the structure of the tissue relates to its function to bone and blood.
Explain major source documents used in job order costing : Explain major source documents used in job order costing system. Discuss the role(s) of information technology in job costing system for Cerdik Sdn. Bhd.
Describe how the wages of an assembler in the plant : Using the flow of manufacturing costs, describe how the wages of an assembler in the plant would be accounted for in this manufacturing company.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd