Learn the combined use of timer and the tracking of user

Assignment Help Basic Computer Science
Reference no: EM13702464

Lab 10 - The Student Game
- Learn the Combined use of Timer and the tracking of user interactions

Deliverables
app.java, myJFrame.java, myJPanel.java, and other necessary Java files

Contents
The objective of the lab is to create a game in which the player has to click on a moving student-button to score.
1. The student button has to move constantly (using the timer)
2. The application has to keep the score
3. The actual score has to be shown.
4. Implement at least one of the extras listed below (#3 to #7)
- level of difficulty: High
- level of usefulness for the final project: Very High

Suggestion: start with the basic timer Java example and made the necessary changes to it.
Suggested steps:
#1 get the student button moving
you need the get timer started
you need a null layout (https://www.dropbox.com/s/629kis94z9v6p3l/Lab10.zip?dl=0)
you need to set a different position for the button every time the timer ticks
#2 keep the score on a separate button, every click on the student button increases the score by 1.
when these two are working, then:
#3 changes the image of the student button when it is clicked
when #3 is implemented, then:
#4 add a slider to make the button move faster or slower
- you need to use the setDelay() method applied to the timer.
when #4 is implemented, then:
#5 makes the movement smooth instead of jumping from one place to another place very far away.
#6 makes the student-button run faster when the mouse approaches it

Work thus far can be found here:
https://www.dropbox.com/s/629kis94z9v6p3l/Lab10.zip?dl=0

Reference no: EM13702464

Questions Cloud

Calculate the electric power input to the oven per unit : The electric reheating oven shown in the figure is used to heat a continuous sheet of metal from 25-1000C The metal speed is such that the strip of metal spends 2 hours inside this oven, The sheet thickness is 1cm and the ambient temperature is 25C w..
The beginning the channel is idle : An ad Hoc network using IEEE802.11 has 4 nodes: N1, N2, N3, N4. Assume that SIFS is 1 unit of time, PIFS 2 units of time, DIFS 3 units of time, and slot time is 2 (these values are not the real values but are taken to simplify the packets sched..
Find the fraction of extraction steam flow : A power plant with one closed FWH has a con- denser temperature of 450C, a maximum pressure of 5 MPa, and a boiler exit temperature of 900C. Extraction steam at 1 MPa to the FWH condenses and is pumped up to the 5-MPa feed water line, where all the w..
Global investment managers and index funds : Explain step by step the way to solve the question - Just to make sure that the work will not include the Global Investment Managers (GIM) and Index funds UK (IFU) from the file.
Learn the combined use of timer and the tracking of user : Lab 10 - The Student Game - Learn the Combined use of Timer and the tracking of user interactions Deliverables app.java, myJFrame.java, myJPanel.java, and other necessary Java files
Determine the exit temperature of the helium : Helium at 800kPa, 600C enters a steady flow turbine and leaves at 100kPa. The helium undergoes an expansion process through the turbine, does work in the amount of 900kj/kg, and loses 50kj/kg of energy by heat transfer to the surroundings.
The blocks will overcome friction : Mud is stopped using a wall made from 1.2 m high x 0.25 m wide rectangular concrete blocks as shown in figure below. Blocks density is 2700 kg/m3, mud density is 1800 kg/m3, and friction coefficient between ground and concrete blocks is f = 0.3 . The..
A six-cylinder four-stroke engine operating : A six-cylinder four-stroke engine operating at 3000 rpm produces 200 kW of total brake power. If the cylinder displacement is 1 L, determine (a) the net work output in kJ per cylinder per cycle, (b) the MEP and (c) the fuel consumption rate in kg/h. ..
Heat transfer coefficient between the coffee and the wetted : Hot coffee of temperature T[infinity] = 90°C is poured into a cup whose wall is initially at the temperature Ti= 10°C. The porcelain wall of the cup is 0.5 cm thick. The heat transfer coefficient between the coffee and the wetted surface is h= 700 W/..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Program that reads a series of whitespace

Write a program that reads a series of whitespace delimited strings from stdin and prints them back out, separated by spaces, in lexicographic order. You may assume that all strings are lower case and that no string has more than 20 characters.

  Display the total and average number of calories burned

Write a condition-controlled while loop that allows the user to enter the calories they burned. Stop looping when the user enters a negative number. Display the Total and Average number of calories burned.

  Write a programme that force the player-controlled class

write a programme that Force the player-controlled class Dog to fall asleep when its energy reaches 0, and once it wakes up, set its energy to 100.

  Decision structures and conditionals

Discuss routine decisions you make throughout your day. How might you implement them using C# decision structures and conditionals?

  Information system to use for stocks and trading futures

Write down some of the many considerations in selecting right information system to use for trading futures and stocks?

  Compare and contrast magnetic tapes

Realize business and organizational data storage and fast access times are much more important than they have ever been.

  Proposed dss design

Proposed DSS Design

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Which of these conditions returns true

Which of these conditions returns true? Check the Java documentation for the inheritance patterns.

  Issue -internet changed political interactions globally

Write a 500 word essay based on the issue of ways in which the internet has changed political interactions globally. These might involve political activity in several specific countries,

  Display an appropriate error message

User Radio Buttons with a shared event procedure and a Select Case to determine which text box (State name or abbreviation) should have the focus and which should be set to Readonly.

  Problem of traveling from one city to another

Describe how the problem of traveling from one city to another could be framed as a production system. What are the states? What are the productions?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd