User Account

All Pages

Laboratory methods of genetic recombination

Assignment Help JAVA Programming
Reference no: EM131104706

Problem:

Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination to bring together genetic material from multiple sources, creating sequences that would not otherwise be found. The letters C, G, A, and T represent nucleotides, the molecules that when joined together, make up the structural units of DNA. Simulate an experiment by searching for the pattern "GAATTC ".  Your code will search for "GAATTC " in the original DNA strand, which is "CTAGAGAATTCCTGA" below. Split that strand into two pieces and place the new DNA, which is "TGATA" below, into the original strand. The new strand should be inserted before the strand being searched for, "GAATTC", to increase the original strand. The user must enter the original strand, the new strand to be inserted, and the sequence to be searched for. Your dialog must look like this, with three inputs and the longer strand as the output:

Original: CTAGAGAATTCCTGA

New: TGATA

Search: GAATTC

Increased: CTAGATGATAGAATTCCTGA

Hints:

  • Assume all inputs are uppercase letters GTAC only. No other letters, no spaces, ...
  • Assume the search string is in the original strand. We will not enter invalid inputs

Reference no: EM131104706

Questions Cloud

Which action would be better : Should stockholder wealth maximization be thought of as a long-term or a short-term goal? For example, if one action increases a firm's stock price from a current level of $20 to $25 in 6 months and then to $30 in 5 years
What are the rights and potential liabilities : What are the rights and potential liabilities of the tug owner, (2) the cargo owner, (3) the Sea Tow, and (4) the Coast Guard. Why? Explain fully. Must be in own words.
What pressure difference is generated to provide fresh air : What pressure difference is generated to provide fresh air within the burrow?
Use the simplex method to solve this model : Joe wants to sell his car. He receives one offer each month and must decide immediately whether to accept the offer. Once rejected, the offer is lost.
Laboratory methods of genetic recombination : Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination to bring together genetic material from multiple sources, creating sequences that would not otherwise be found
Insert a probe into a turbulent flow in a circular conduit : 1) You are developing a sampling protocol whereby you're going to insert a probe into a turbulent flow in a circular conduit of radius R. a. Using a description of a velocity profile typical of turbulent flow in a circular conduit, solve for that pos..
Prepare a single step income statement : Prepare a single-step income statement for Allen for 2004. Allen has 100,000 shares of stock outstanding.
Describe the four basic categories of innovations : Briefly describe the four basic categories of innovations. Briefly distinguish between product R&D and process R&D. Briefly describe the four general methods of managing two different cultures.
Minimizes the expected total discounted cost : Joe wants to sell his car. He receives one offer each month and must decide immediately whether to accept the offer. Once rejected, the offer is lost.

Reviews

Write a Review

JAVA Programming Questions & Answers

  Recursive factorial program

Write a class Array that encapsulates an array and provides bounds-checked access. Create a recursive factorial program that prompts the user for an integer N and writes out a series of equations representing the calculation of N!.

  Hunt the wumpus game

Reprot on Hunt the Wumpus Game has Source Code listing, screen captures and UML design here and also, may include Javadoc source here.

  Create a gui interface

Create GUI Interface in java programing with these function: Sort by last name and print all employees info, Sort by job title and print all employees info, Sort by weekly salary and print all employees info, search by job title and print that emp..

  Plot pois on a graph

Write a JAVA program that would get the locations of all the POIs from the file and plot them on a map.

  Write a university grading system in java

University grading system maintains number of tables to store, retrieve and manipulate student marks. Write a JAVA program that would simulate a number of cars.

  Wolves and sheep: design a game

This project is designed a game in java. you choose whether you'd like to write a wolf or a sheep agent. Then, you are assigned to either a "sheep" or a "wolf" team.

  Build a graphical user interface for displaying the image

Build a graphical user interface for displaying the image groups (= cluster) in JMJRST. Design and implement using a Swing interface.

  Determine the day of the week for new year''s day

This assignment contains a java project. Project evaluates the day of the week for New Year's Day.

  Write a java windowed application

Write a Java windowed application to do online quiz on general knowledge and the application also displays the quiz result.

  Input pairs of natural numbers

Java program to input pairs of natural numbers.

  Create classes implement java interface

Interface that contains a generic type. Create two classes that implement this interface.

  Java class, array, link list , generic class

These 14 questions covers java class, Array, link list , generic class.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd