Johnson inc owns control over kaspar inc johnson reports

Reference no: EM13584312

Johnson, Inc. owns control over Kaspar Inc, Johnson reports sales of $400,000 during 2013 while Kaspar reports $250,000. Kaspar transferred inventory during 2013 to Johnson at a price of $50,000. On December 31, 2013, 30% of the transferred goods are still in Johnson's inventory. Consolidated accounts receivable on January 1, 2013 was $120,000, and on December 31, 2013 is $130,000. Johnson uses the direct approach in preparing the statement of cash flows. How much is cash collected from customers in the consolidated statement of cash flows?

Reference no: EM13584312

Questions Cloud

Why are frameshift mutations insertions and deletions more : 1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

The company declared dividends of 6000 on preferred stock : burke company shows the following condensed income statement information for the year ended december 31 2010income

1 what did the astronomer edwin hubble discover about : 1 what did the astronomer edwin hubble discover about galaxies in the 1920s?2 what formula is used to calculate the

Give an example of a researchstatistic study that you : give an example of a researchstatistic study that you encountered this week in your life outside of this course. this

Johnson inc owns control over kaspar inc johnson reports : johnson inc. owns control over kaspar inc johnson reports sales of 400000 during 2013 while kaspar reports 250000.

Using the internet or strayer databases research the : each state within the united states has its own unique judicial selection process within its own court system.using the

Large corporation acquired and placed in service the : large corporation acquired and placed in service the following 100 business-use assets. large did not elect sec. 179

Zia motors is a small automobile manufacturer chris rickard : zia motors is a small automobile manufacturer. chris rickard the companys president is currently evaluating the

A computer system requires all uses to log on using a 6 : a computer system requires all uses to log on using a 6 character password. if each character can be either a digit

User Account

All Pages