User Account

All Pages

Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

Questions Cloud

What is under armour doing to make brand personally relevant : 1. What is Under Armour doing to make its brand personally relevant, surprising, and easy to process?
Prepare summary journal entries for april : Prepare summary journal entries for April (without disposing of under- or overallocated conversion costs). Assume no direct materials variances.
What factors should sido consider before choosing a supplier : Which supplier should Sido choose? Show all calculations. What other factors should Sido consider before choosing a supplier?
Graded for technical content and from a grammar perspective : Write about Wal-Mart. It will be graded for technical content and from a grammar perspective. The paper should be approximately 2,000 words in length. References need to be cited throughout the paper and in the reference section
Is this a strand of dna or rna : If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code), What would happen to the reading frame if three bases were inserted/del..
Two network security software tools : They must be of a type listed on page 22. Other types are not acceptable unless explicitly agreed by the module leader. c. They must be agreed with your module leader. The means of reaching this agreement are described below.
Explain the importance of pointers : Assuming an array has to be sorted, inserting a new element required shifting, in the worst case, n elements, where n is the number of elements in the array, i.e.:
What are the criteria for good primers in a pcr reaction : What are the criteria for "good" primers in a PCR reaction? Describe how you would use site-directed mutagenesis to change a BamHI restriction site into an EcoRI site.
Factors that influence buying behavior : Factors that influence buying behavior - Cultural, social, personal and psychological. Include consumers buying decision process.

Reviews

Write a Review

Biology Questions & Answers

  Q1 how is it that an open ocean produces the highest net

q1. how is it that an open ocean produces the highest net primary productivity of earths ecosystems so far net primary

  Define which phase of the cell growth or division

define which phase of the cell growth or division. In a normal diploid cell, polyploidy can be induced by treatment with colchicine.

  Was integrity of this exercise compromised

Suppose you had poured iodine on your plate and noticed clearings in the uninoculated area, as well as around both of your transferred cultures. What are some possible explanations for this occurrence? Was integrity of this exercise compromised? W..

  Transpiration is an important aspect of ecosystem dynamics

Transpiration is an important aspect of ecosystem dynamics. It essentially is the second most important concept associated with plants and life being on land, photosynthesis being first. In no more than four sentences, explain how transpiration..

  Describe the hormonal regulation of reproduction in male

Describe the hormonal regulation of reproduction in male and female humans. (Hint: Include the ovarian and uterine cycles and what happens during pregnancy.)

  How does organization related to funtion

How is the human body organized to accomplish the neccesitiesof life?

  Find the role of uncoupling mitochondrial membrane proteins

Insulin is released from pancreatic b cells when blood glucose levels increase and glucagon is released from pancreatic a cells when blood glucose levels decrease.

  Describe the relationship between intrapulmonary pressure

Describe the relationship between intrapulmonary pressure, atmospheric pressure, and air flow during normal inspiration and expiration, referring to Boyle's law.

  How would you expect thi sdrug to affect cellular responses

an asthma patient receives a perscription for theophylline. how would you expect thi sdrug to affect cellular responses to hormones that activate adenylate cyclase? Why?

  How numerous map units are they apart

How many 10 micrometer yeast cells could fit across the field. In a guinea pig, black is dominant to brown, and solid colour is dominant to spotted. A heterozygous black, solid-coloured pig is mated with a brown, spotted pig.

  Which of these statements is true of earthworms

Which of these statements is true of earthworms?

  Characters on a phylogeny of fungi

Place the following characters on a phylogeny of fungi (with animals as an outgroup), Flagella, Multicellularity, Non-motile sperm, Arbuscular mycorrhizae, Macroscopic reproductive structures.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd