User Account

All Pages

Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

Questions Cloud

What is under armour doing to make brand personally relevant : 1. What is Under Armour doing to make its brand personally relevant, surprising, and easy to process?
Prepare summary journal entries for april : Prepare summary journal entries for April (without disposing of under- or overallocated conversion costs). Assume no direct materials variances.
What factors should sido consider before choosing a supplier : Which supplier should Sido choose? Show all calculations. What other factors should Sido consider before choosing a supplier?
Graded for technical content and from a grammar perspective : Write about Wal-Mart. It will be graded for technical content and from a grammar perspective. The paper should be approximately 2,000 words in length. References need to be cited throughout the paper and in the reference section
Is this a strand of dna or rna : If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code), What would happen to the reading frame if three bases were inserted/del..
Two network security software tools : They must be of a type listed on page 22. Other types are not acceptable unless explicitly agreed by the module leader. c. They must be agreed with your module leader. The means of reaching this agreement are described below.
Explain the importance of pointers : Assuming an array has to be sorted, inserting a new element required shifting, in the worst case, n elements, where n is the number of elements in the array, i.e.:
What are the criteria for good primers in a pcr reaction : What are the criteria for "good" primers in a PCR reaction? Describe how you would use site-directed mutagenesis to change a BamHI restriction site into an EcoRI site.
Factors that influence buying behavior : Factors that influence buying behavior - Cultural, social, personal and psychological. Include consumers buying decision process.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd