Important concepts of how denial of service

Assignment Help Basic Computer Science
Reference no: EM131038989

The course module #4 covers very important concepts of how Denial of Service (DoS) attacks work. However, the module does not discuss detection, prevention, or mitigation of DoS attacks (or Distributed DoS). The task of this individual assignment is to write a research paper/report.

Topic of the Paper:

Technique(s) or scheme(s) or method(s) for detecting, preventing or mitigating DoS or Distributed DoS (DDoS) attacks.

Assignment Guidelines

The following must be considered when you write the report:

  1. Select 3-4 research papers which discuss detection, prevention, or mitigation techniques for DoS or DDoS attacks:
    1. The research papers must be published by a peer reviewed journal or be published in conference proceedings (e.g., IEEE, ACM, IBM Systems Journal, Lecture Notes in Computer Science (LNCS), etc.).
    2. You must not choose papers or research works from magazines or periodicals that are not research-oriented (e.g., Wikipedia, SANS, etc.).
    3. Briefly explain your rationale for selecting a specific research paper.
    4. Allocate sufficient time to read the research papers. Reading a research paper requires more time than most people realize.
  2. Summarize each research paper and identifythree different detection, mitigation, or prevention techniques described in the papers you selected. For example: you can have a) one detection + two prevention methods, OR b) one detection + two mitigation methods, OR c) one detection + one prevention + one mitigation
  3. Describe how each technique works. Clearly describe (in detail using your own words), how each technique works. Assume that you are explaining the author's technique to someone with a fairly strong fundamental knowledge in network and security (e.g., a first year computer science graduate student) and assume the student has no knowledge of the author's research (never read the article before). Discuss each technique or method using the following questions:
    1. Is the proposed technique a promising, practical approach which can be effectively implemented into an existing platform? Clearly explain your answer.
    2. What are the strengths and weaknesses (limitations) of this technique?
  4. Make sure there are No IPR(Intellectual Property Right) issues. This requires the following:
    1. Re-draw all figures and tables.
    2. Summarize all concepts using your own words.
    3. Do not copy any part of text or unmodified figures (short quotes are acceptable.)
    4. Cite references as needed using APA format.
  5. To support your claims or statements, you may cite/reference non-peer reviewed papers and journals (including white papers, SANs documents, etc.; do not have to be academic papers or articles, however, no Wikipedia or blogs).

Submission Guidelines

  • Print format: MS Word or PDF format.
  • The general structure of your research paper:

Name and Title

Brief Intro

Background (if needed)

Main Sections

Conclusion (if needed)

References

The paper length: 9-10 double space pages (good, solid content which is factual, relevant, and concise).

Follow the APA format.

Turnitin.com requirement: Please see the Turnitin Conference posting for Turnitin requirements and metrics.

Reference no: EM131038989

Questions Cloud

What is your estimate at the stocks current value : What is the firm's WACC, assuming it must issue new stock to finance its capital budget - what is your estimate at the stock's current value?
Differences between the direct and indirect presentation : What are the differences between the direct and indirect presentation of cash flows? Why does the Financial Accounting Standards Board allow both methods? Which do you prefer? Why?
Indicate whether each transaction resulted in a cash flow : Analyze the transactions and indicate whether each transaction resulted in a cash flow from operating activities, investing activities, financing activities, or noncash investing and financing activities.
What is the npv of opening a new store : Assuming that the average comic book store has a life of about 10 years, what is the NPV of opening a new store if the required rate of return in this business is 10%?
Important concepts of how denial of service : The course module #4 covers very important concepts of how Denial of Service (DoS) attacks work. However, the module does not discuss detection, prevention, or mitigation of DoS attacks (or Distributed DoS). The task of this individual assignment ..
How do ethics affect a company''s financial results : Do you think the Sarbanes-Oxley Act has made a difference in the ethical behavior of companies regarding their financial accounting? Why or why not?
Stereotype entity classes : Research and explain the three stereotype entity classes: Boundary Class, ControlClass, and Entity Classes. Show the graphical notations and provide exemplary diagrams. Finally, describe their roles in system design.
Bcg matrix and analysis worth performing : Would a BCG Matrix and analysis worth performing if you do not know the profits of each segment? Why ?
Benefit of using design patterns in software design : This is the second design pattern that we have focused on this semester. So, for our discussion this week, explain the benefit of using design patterns in software design. Explain what fundamental software design principles underlie both of these ..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Writing a program in java about assigning integer values

Write a program to assign the integer values 1 through 25 to a 25-element integer array. Then, print the array as five separate lines, each containing five elements separated by commas.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Create a new file called testwork

Create a new file called TestWork.scr Change the permissions on this new file to add the execute bit for user, group, and owner.

  How a company developed a template for a web page

Marion has argued that with modern information technologies, collocation of team members is no longer important. How would you respond to this claim?

  Define a header and data format

Purpose: This program will generate a series of random numbers and produces a table containing these values and some statistics about them. The program should define a Header and Data format string to output results as shown in the sample at the bo..

  What does moody suggest is scarce in the free software world

Economics has been called the study of scarcity. It is only possible to sell what is scarce, because what is not scarce (e.g., abundant) has no monetary value. What does Moody suggest is scarce in the Free Software world

  Write some code that exchanges their values

There are two string variables, s1 and s2, that have already been declared and initialized, write some code that exchanges their values.

  Design a nine-step counter to count

Design a nine-step counter to count in the following sequence using D flip-flops (TTL 7474): 0011, 0101, 1001, 1000, 1011, 1010, 0110, 0100, 0111, 0011, include in the design a means for resetting the counter to 0011.

  Modify the range accordingly or terminate the program

modify the range accordingly or terminate the program. The program must do up to 20 guesses

  Which shipper service to choose for company

Your task is to choose the best shipper for company. Compare these shippers, like FedEx (www.fedex.com), UPS (www.ups.com), and the U.S. Postal Service (www.usps.gov).

  Exploited both network and host vulnerabilities

Several computers in your company have recently been compromised. It was discovered that your company network had been under attack for several months. However, these attacks had not been previously detected. The attackers exploited both netwo..

  Identify the major deliverables and tasks for the project

Determine the duration of each detailed level task to build a complete project plan which will include the overall timeline and duration of the project.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd