Implement the logic telling the csu staff when to approve

Assignment Help Basic Computer Science
Reference no: EM131190921

Charles Sturt University (CSU) has opened an IT Doctorate study in Sydney Study Centre. The applicant should has a master degree in IT or a master degree in electrical engineering. The applicant should also has completed project subject (e.g. ITC570, ITC571, ...) in his master degree. Before CSU management staff approve student's application, they have to check student master degree if it meet the requirements and also check if the student completed project subject or not in his master degree. After checking applicant documents, CSU staff has come to the following conclusions:

· Approve if applicant has one of the required master degrees and has completed project subject.

· Approve if applicant has two of the required master degrees and has completed project subject.

· Don't approve otherwise.

Construct a truth table and find the minimized Boolean function to implement the logic telling the CSU staff when to approve.

Draw a circuit diagram for the Boolean function.

Reference no: EM131190921

Questions Cloud

Find the minimized boolean function : Construct a truth table and find the minimized Boolean function to implement the logic telling the CSU staff when to approve.
Review the internet to research the concept of peak oil : Review the internet to research the concept of "peak oil". Based on your research, write a one page technical memo discussing your opinion of whether we have reached peak oil, or whether this is sometime in the future.
What is the present value of the dividend stream : Chapman Inc.'s Mexican subsidiary, V. Gomez Corporation, is expected to pay to Chapman 50 pesos in dividends in 1 year after all foreign and US taxes have been subtracted. The exchange rate in 1 year is expected to be 0.10 dollars per peso. What is t..
Are there certain factors that you believe would make : Research by Milgram (1970) has also shown that a person is more likely to receive assistance from a bystander if the event takes place in a rural area in comparison to an urban environment. Why do you think this is the case?
Implement the logic telling the csu staff when to approve : Construct a truth table and find the minimized Boolean function to implement the logic telling the CSU staff when to approve.
Calculate the average rate of return for each year : Calculate the average rate of return for each year from the above information - What rate of return would you have earned on your investment had you purchased the shares on December 5, 2007?
Low-risk investments comparable to the retirement annuity : An insurance agent is trying to sell you an? immediate-retirement annuity, which for a single amount paid today will provide you with ?$7200 at the end of each year for the next 25 years. You currently earn 7?% on? low-risk investments comparable to ..
Determine the account balance on february 1 : Assuming the February 28 balance of Accounts Payable was $58,540, determine the account balance on February 1.
What is the contribution margin for each type of calculator : The fixed costs for the company are $50,000. What is the contribution margin for each type of calculator? What is the sales mix by sales volume and by unit? What is the weighted-average unit contribution

Reviews

Write a Review

Basic Computer Science Questions & Answers

  How i should write out the source file

Given struct vector scale_vector (struct vector v, double scalar) for the header file.

  Strategies-methodologies to accomplish

Given a requirement to integrate WDAs into an Enterprise Intranet, what are 2 applications that would be candidates for that, and illustrate strategies/methodologies to accomplish that.

  What is the estimated payback period of a project

What is the estimated payback period of a project whose cost is $90,000 and benefits estimated to be $60,000 in each of the next three years?

  Recognize components of system cpu

Recognize the following components of your system: type of central processing unit (CPU), amounts of random access memory (RAM) and read-only memory (ROM), input and output devices, and types of storage.

  Find a simplified expression for function

find a simplified expression for F = A?BC?D + A?B?D + A?CD + ABD + ABC - Assuming that the inputs ABCD = 0101, BCD = 1001, ABCD = 1011 never occur,

  How much ram is installed on your computer?

How much RAM is installed on your computer?

  Write a program that takes in input a set of search terms

write a program that takes in input a set of search terms, connects to Google's search engine, queries for the search terms, retrieves the HTML page containing the search results

  Uml state diagram situations in chess game

You are required to draw a UML state diagram to represent the following situations in Chess game.

  Write a small program in matlab

Write a small program in MATLAB that evaluates the gradient at each point in a two-dimensional grid in the space -5 ≤ x 1 ≤ 5. Choose an appropriate grid spacing

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Finding a mincost maxflow of the new network

These flows all have the same (maximal) value, but their costs (the sum of the products of edge flows and edge costs) differ. The maxflow in the center has minimal cost (no maxflow has lower cost).

  Implement fast-forward and reverse for mpeg streams

What problems do you run into if you limit your mechanism to displaying I frames only? If you don't, then to display a given frame in the fast-forward sequence, what is the largest number of frames in the original sequence you may have to decode?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd