Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Question: A DNA sequence containing a short bacterial gene is shown below. The DNA strand shown is the template strand for the RNA synthesis. (meaning the original DNA strands have already unzipped and this is the template to use) Answer the following questions about this sequence and be sure to answer all parts of the questions.
3' GACTCACTACGATAGCCCCCTCGGATGCACT 5'
A. Below this DNA template, provide the sequence of the mRNA that would be transcribed from the gene.
B. Use the mRNA generated above to show how the process of translation would occur from this mRNA. Utilize the genetic code in your textbook. Or from the powerpoint. For this part of your answer, be sure to first find the start codon in your mRNA and highlight the start codon in yellow. Also, be sure to identify the entire amino acid sequence of the protein coded by this gene and point out where the peptide bonds in your answer.
C. Specifically explain and show (completely) what the result would be if the T in boldface were mutated and were instead an G. Explain what type of mutation this would be and show what full specific effect it would have on the protein now produced. Be sure to show the full process with the mutated protein sequence.
Compare and contrast nervous and endocrine signaling - how are they similar and different, and what are advantages to each type of system?
The observation of their children is A and AB. This means their children is not biological children?
"It is more difficult to find commercially available antibodies for immunoprecipitation (that actually work), than antibodies for western blots. This company sells an antibody that works even for a native western blot - not a common technique.
Describe a situation where to use positive or negative outcomes that demonstrates why using the writing process is important in any type of writing activity.
Briefly describe one significant way in which rootnodules, filled with nitrogen-fixing bacteria, are similar to cancerous tumors in humans
Describe why certain medical conditions prohibit blood donation. Explain the testing process after the donation of blood.
The magnetic susceptibility and number of unpaired electrons were determined which can help understand the compound's paramagnetic propertie
In mice, dwarfism is caused by an X-linked recessive allele, and pink coat is caused by an autosomal dominant allele. If a dwarf female from a pure line is crossed with a pink male from a pure line, Determine the phenotypic ratios in the F1 and F2 in..
You are working as a receptionist at the only family practice in a small town in Idaho while you are studying to become a physician's assistant.
The productivity standards for your new observation unit are set. You must meet the minimum target of 95% with a maximum target of 105%.
To what extent have you been engaged in implementing or changing strategies in some or all of the following areas: sales territories or boundaries, opening or closing facilities, hiring or reducing employees, changing pricing strategy, developing or ..
If you were to design a radio message to be sent out into space as a first contact attempt with an extraterrestrial civilization, what information would you inc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd