User Account

All Pages

How much does looney need to borrow in dollars today

Assignment Help Accounting Basics
Reference no: EM132745179

Question: Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period and the current spot rate of the euro is $1.32. If Looney were to use a money market hedge to cover the payables (borrow U.S. dollars, invest in Germany and use the exact value of the proceeds, principal plus interest, to pay off the amount due in euros), how much does Looney need to borrow in dollars today (round to the nearest dollar)?

Reference no: EM132745179

Questions Cloud

Concepts of aerobic and anaerobic respiration : Using the concepts of aerobic and anaerobic respiration, explain why a person can only perform an all-out sprint for only about 30 seconds but another person
Represent the complementary strand produced : What would represent the complementary strand produced during replication? (write out the correct sequence and indicate 3' and 5' ends)
Example ray diagram of the eye : The human eye is a very complex organ capable of using light rays to create images and extract millions of colors. explain how it works in relation to light
Create a vegetable tray for a party : What could you do if you needed to create a vegetable tray for a party but your carrots looks a little wrinkly and your celery is limp
How much does looney need to borrow in dollars today : Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period.
How dose renewable resources help : How dose renewable resources help with climate change compared to non renewable resources?
New strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine.
Which of the two types evidence is more reliable : The following are eight situations, each containing two means of accumulating evidence: Confirm accounts receivable with business organizations versus.
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation?

Reviews

Write a Review

Accounting Basics Questions & Answers

  How much control does fed have over this longer real rate

Hubbard argues that the Fed can control the Fed funds rate, but the interest rate that is important for the economy is a longer-term real rate of interest.   How much control does the Fed have over this longer real rate?

  Coures:- fundamental accounting principles

Coures:- Fundamental Accounting Principles: - Explain the goals and uses of special journals.

  Accounting problems

Accounting problems,  Draw a detailed timeline incorporating the dividends, calculate    the exact Payback Period  b)   the discounted Payback Period. the IRR,  the NPV, the Profitability Index.

  Theory of interest - term structure of interest rates

Term Structure of Interest Rates

  Write a report on internal controls

Write a report on Internal Controls

  Prepare the bank reconciliation for company

Prepare the bank reconciliation for company.

  Cost-benefit analysis

Create a cost-benefit analysis to evaluate the project

  Theory of interest

Theory of Interest: NPV, IRR, Nominal and Real, Amortization, Sinking Fund, TWRR, DWRR

  Liquidity and profitability

Distinguish between liquidity and profitability.

  What is the expected risk premium on the portfolio

Your Corp, Inc. has a corporate tax rate of 35%. Please calculate their after tax cost of debt expressed as a percentage. Your Corp, Inc. has several outstanding bond issues all of which require semiannual interest payments.

  Simple interest and compound interest

Simple Interest, Compound interest, discount rate, force of interest, AV, PV

  Capm and venture capital

CAPM and Venture Capital

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd