User Account

All Pages

How much does looney need to borrow in dollars today

Assignment Help Accounting Basics
Reference no: EM132745179

Question: Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period and the current spot rate of the euro is $1.32. If Looney were to use a money market hedge to cover the payables (borrow U.S. dollars, invest in Germany and use the exact value of the proceeds, principal plus interest, to pay off the amount due in euros), how much does Looney need to borrow in dollars today (round to the nearest dollar)?

Reference no: EM132745179

Questions Cloud

Concepts of aerobic and anaerobic respiration : Using the concepts of aerobic and anaerobic respiration, explain why a person can only perform an all-out sprint for only about 30 seconds but another person
Represent the complementary strand produced : What would represent the complementary strand produced during replication? (write out the correct sequence and indicate 3' and 5' ends)
Example ray diagram of the eye : The human eye is a very complex organ capable of using light rays to create images and extract millions of colors. explain how it works in relation to light
Create a vegetable tray for a party : What could you do if you needed to create a vegetable tray for a party but your carrots looks a little wrinkly and your celery is limp
How much does looney need to borrow in dollars today : Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period.
How dose renewable resources help : How dose renewable resources help with climate change compared to non renewable resources?
New strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine.
Which of the two types evidence is more reliable : The following are eight situations, each containing two means of accumulating evidence: Confirm accounts receivable with business organizations versus.
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation?

Reviews

Write a Review

Accounting Basics Questions & Answers

  Hurdle rate or the minimum acceptable return

Please explain the pros and cons of using the firm WACC in evaluating its divisional managers and projects. Remember that WACC can be interpreted as a hurdle rate or the minimum acceptable return. Limit your answers to no more than 10 sentences.

  What amount of the contribution is deductible

Phil, age 30, is married and files a joint return with his spouse. What amount of the contribution is deductible

  What amount of organization expense should be reported

On January 1, 2020, Wildhorse incurred organization costs of $250,000. What amount of organization expense should be reported in 2020

  How much gross profit would be recognized

Pool Contractors (PC) entered into a contract to build a solar heated swimming complex for $1,800,000. How much gross profit would be recognized

  Describe accounting information systems

Compare/contrast the classic controls with their adaptations for technology. Have one or more of the classic controls become obsolete when applied in technology

  The historical cost concept reflects the fact that

the historical cost concept reflects the fact that financial accounting practice favors reliability over relevance

  Estimates for direct labor and labor-related costs

Prepare cost estimates for direct labor and labor-related costs for the contract, showing the following:

  Customers send requests for auto insurance into the

customers send requests for auto insurance into the asheville sales office where sales clerks prepare policy request

  Amount of ordinary business income

a. What amount of ordinary business income is allocated to Jane? b. What is the amount and character of seperately stated items allocated to Jane? c. What is Jane's basis in her XYZ corp. stock at the end of the year?

  For the year beta had beginning total liabilities of 30000

for the year beta had beginning total liabilities of 30000 and ending total liabilities of 20000. during the year total

  Compute the unit product cost under variable costing

Compute the unit product cost under variable costing and absorption costing and Calculate the net operating income under variable costing

  Compute the predetermined overhead rate for each company

Compute the predetermined overhead rate for each company, Using T-accounts, record applied and actual overhead and the entry to close

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd