How many neurons constitute a neighborhood

Assignment Help Basic Computer Science
Reference no: EM131240244

Study the impacts of different values of neighborhood range on a network's behavior and self-organization. This number indicates how many neurons constitute a neighborhood (i.e., how many undergo forced teaching when a winner neuron is self-learning). This number should depend on network size and the default setting. However, we suggest as an exercise a careful examination of its impact on network behavior. Note that larger neighborhood range numbers visibly slow the learning process.

Reference no: EM131240244

Questions Cloud

Determining the feasibility study : IT systems are a major capital investment and the systems analyst is called to investigate the feasibility of a system and help answer the questions - Will the system pay for itself?
What is the expected effect of increasing horsepower : What is the expected effect of increasing horsepower on 0-60 time? - Interpret your estimated coefficient on WEIGHT.
Study the impact of changing the epsalpha coefficient : You can set a value 1 to this coefficient and the learning coefficients will not decrease or set a value slightly more than 1, which will result in more "brutal" learning at every step. Describe the results.
Benefits of using wsus over the traditional imaging process : What are the benefits of using WSUS over the traditional imaging process?
How many neurons constitute a neighborhood : This number should depend on network size and the default setting. However, we suggest as an exercise a careful examination of its impact on network behavior. Note that larger neighborhood range numbers visibly slow the learning process.
Why might the use of equity method become more appropriate : What factor should be considered in determining whether equity-method reporting is appropriate?  Why might the use of the equity method become more appropriate as the percentage of ownership increases?
Derive patient from the class person : Define two classes, Patient and Billing, whose objects are records for a clinic. Derive Patient from the class Person given in Listing 8.1. A Patient record has the patient's name (defined in the class Person) and identification number (use the ty..
Method of direct proof to prove that statement : Suppose a and b are integers. If a | b, then a | (3b3 - b2 +5b). Use the method of direct proof to prove that statement.
Discuss the main disadvantages of financial regulations : Discuss the main advantages/disadvantages of financial regulations. What is the significance of the SEC and the FCM for the financial market?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Perform resource management functions

Are privileged calls that are used to perform resource management functions, which are controlled by the operating system?

  How can auditors or mas staff assist

What are the potential ramification of poorly written IT contracts? What is the auditor's role? How can auditors or MAS staff assist?

  Explaining costs are classified as opex or capex

The managers of the five business units. They will need to know the following about each option in terms that nontechnical staff can readily understand: Whether the costs are classified as opex or capex.

  Demonstrate applied knowledge of people

demonstrate applied knowledge of people

  Website has a duty to be familiar with drug laws

Assume a foreign website sells drugs which are not approved by regulatory agencies for sale to citizens of another country. Do you believe that website has a duty to be familiar with drug laws throughout the world?

  Business information processing

For most business information processing, what do you believe are the critical or limiting characteristics of today's computing systems-CPU speed, memory capacity, DASD capacity, internal communication speed, input-output speed, other factors, or ..

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Implement new forms of computer-mediated technology

How would implementing new forms of computer-mediated technology influence your organization's communication? What is the significane of managers selecting suitable channel for message distribution in Information Age?

  Program that prints your first name on the screen

Write an assembly language program that prints your first name on the screen. Use the .ASCII pseudo-op to store the characters at the bottom of your program. Use the CHARO instruction to output the characters.

  Security and compliance

Security and compliance are interconnected in important ways. What happens if you have a policy, but you cannot assure compliance? There is no automated enforcement mechanism. You cannot be sure if policy is followed or not.

  Demo availability and the latest version

Research two more alternatives for CASE tools. Include cost, demo availability and the latest version. Be sure to include your references.

  Design a java class to implement the add

Design a Java class to implement the "add, remove and isEmpty" functions Then design another class (including the main method) to test the above functions by using the following operations (assume the queue initially is empty).

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd