How many dna fragments would be produced

Reference no: EM1339977

How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence?

5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'

Reference no: EM1339977

Questions Cloud

What are the physical changes required in the body : What are the physical changes needed in the body that would require to happen in order for our bodies to live forever. Changes such as telomerase activity, collagen flexibility, environmental changes, role of the immune system, DNA repair enzymes:..

Which nation has an comparative advantage : Which nation has an comparative advantage in the production of tungsten.

Limitations for implementing pert and crm in organization : What are the difficulties or limitations for implementing PERT and CRM in the organization?

Distribution from stock bonus plan : Randy, age 63, is a participant in the stock bonus plan of XYZ, Inc., Which of the following correctly describes Randy's tax consequences in year 6 from this distribution if Randy does not sell the XYZ stock until year 8?

How many dna fragments would be produced : How many DNA fragments would be produced.

Suppose that corn production requires only : Suppose that corn production requires only land and can production requires only labor.

Capturing the lincolns body : What was the incident and why did they want to steal Lincoln's body?

Explain working with non-governmental organizations : Explain Working with Non-Governmental Organizations- Schmidt Gifts and Novelties and What are the potential media reactions whether or not action is taken by Schmidt Gifts and Novelties

Explaining use of wbs in a project : How and why you would use a WBS in a project? No particular project, just got stuck on this part of the assignment and needed some input.

User Account

All Pages