How many amino acids long will the small protein

Assignment Help Biology
Reference no: EM132186222

The following double stranded DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA, UAG, and UGA.

5' ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'

3' TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'

How many amino acids long will the small protein be that is encoded by this "gene"?

Reference no: EM132186222

Questions Cloud

Explain each quality in your own words : Prior to completing this assignment, read page 141 of Bensley and Brookins-Fisher (2009) and examine the nine qualities that make a good leader.
Why did you choose to become a teacher : Why did you choose to become a teacher? What excellence in teaching have you observed as a student or during observations?
In what way does scripture influence your decision to work : Discuss economic theory related to the quote above. Be sure to include a definition of Labor Force Participation Rate (LFPR) within your discussion.
Analyze a recent article from the wall street journal : You are required to read and analyze a recent article from The Wall Street Journal, each covering a different topic addressed in the course.
How many amino acids long will the small protein : How many amino acids long will the small protein be that is encoded by this "gene"?
What are the arguments being made about the site use : You must identify an important debate happening somewhere within the City of Los Angeles. The debate must involve the use of private and/or public space.
What strategies might you suggest to address the gap : What if...you were asked to be on an early childhood advisory committee for your community? What ideas could you offer to help promote children's success.
Events associated with the development of an ovum : Describe the regulation of spermatogenesis and the regulation of the endocrine events associated with the development of an ovum.
Examine the effectiveness of a multicultural curriculum : Develop a 5 page paper on your philosophical approach to Multicultural Education. Your paper must include the following items.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd