User Account

All Pages

How many amino acids long will the small protein

Assignment Help Biology
Reference no: EM132186222

The following double stranded DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA, UAG, and UGA.

5' ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'

3' TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'

How many amino acids long will the small protein be that is encoded by this "gene"?

Reference no: EM132186222

Questions Cloud

Explain each quality in your own words : Prior to completing this assignment, read page 141 of Bensley and Brookins-Fisher (2009) and examine the nine qualities that make a good leader.
Why did you choose to become a teacher : Why did you choose to become a teacher? What excellence in teaching have you observed as a student or during observations?
In what way does scripture influence your decision to work : Discuss economic theory related to the quote above. Be sure to include a definition of Labor Force Participation Rate (LFPR) within your discussion.
Analyze a recent article from the wall street journal : You are required to read and analyze a recent article from The Wall Street Journal, each covering a different topic addressed in the course.
How many amino acids long will the small protein : How many amino acids long will the small protein be that is encoded by this "gene"?
What are the arguments being made about the site use : You must identify an important debate happening somewhere within the City of Los Angeles. The debate must involve the use of private and/or public space.
What strategies might you suggest to address the gap : What if...you were asked to be on an early childhood advisory committee for your community? What ideas could you offer to help promote children's success.
Events associated with the development of an ovum : Describe the regulation of spermatogenesis and the regulation of the endocrine events associated with the development of an ovum.
Examine the effectiveness of a multicultural curriculum : Develop a 5 page paper on your philosophical approach to Multicultural Education. Your paper must include the following items.

Reviews

Write a Review

Biology Questions & Answers

  What type of anemia is most likely for ann

Considering the circumstances and the preliminary work-up, what type of anemia is most likely for Ann?

  Which of the statements about immature naïve b cells

Which of the following statements about immature naïve B cells that have been released from the bone marrow is not true?

  Write a paer on genetically modified organisms

Select one of the topics listed below: 1. Genetically modified organisms (GMOs). 2. Stem cells. 3. Fracking (hydraulic fracturing) and tar sands (oil sands)

  Chromosomes emmbedded in DNA strand

What makes up DNA i mean are the chromosomes emmbedded in DNAstrand or are they seprate. The coiled DNA is it also composed of chromosomes or are they seprete?

  Q which of the subsequent statements is true about

q. which of the subsequent statements is true about phylogeny as represent by a phylogenetic tree?i descendant groups

  Why did marshall presentation lead patricia

Why did Marshall's presentation lead Patricia to think he had influenza and not a cold? Why is it important to medically evaluate

  Volume and accuracy of the pipette

What size piper Re accurately measures 0.8ml of fluid? Including the volume and accuracy of the pipette.

  What was the genotype of the original heterozygous females

Female Drosophila heterozygous for three recessive mutations e (ebony body), st (scarlet eyes), and ss (spineless bristles) were testcrossed, and the following progeny were obtained: Phenotype Number wild-type 67 ebony 8 ebony, scarlet 68 ebon..

  High white blood cell count

If a person complete blood count shows an abnormally high white blood cell count, and you notice that the predominant white cells are lymphocytes

  What proportion of offspring will show dominant phenotype

If all capitol letter alleles show complete dominance and each of the genes is independently assorted, what proportion of the offspring will show the dominant phenotype at all genes?

  Chromosomal condition results in an organism

Determine chromosomal condition results in an organism being only half as fertile as a wild type individual of the same species?

  Provide an explanation for your prediction

A new virus is infecting people's hearts. This virus is specific to the cardiac muscle and spreads through gap junctions. When it encounters cells without gap junctions.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd