Genetic code tablerelating to amino acids to mRNA codons

Assignment Help Biology
Reference no: EM13534592

Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage? m RNA is to be transcribed from the entire underlinedsequence.Remember that mRNA usesU in place of T and proeinsynthesisbegins with AUG.

CTGACGTATGGCTAACTATTGTCATATATTGGACCGGGAGAACCGTGCGACCGAAATGGCGACCCATGTGGAACGGTATTGGGAATATTGTAATAGCGTGTA
GACTGCATACCGATTGATAACAGTATATAACCTGGCCCTCTTGGCACGCTGGCTTTACCGCTGGGTACACCTTGCCATAACCCTTAATAACATTATCGCACAT-  
mRNA?
protein?
The message??

Reference no: EM13534592

Questions Cloud

Immune system as a whole to respondto invading pathogens : How do specificregions of the body inform the immune system as a whole to respondto invading pathogens?
Example of a feedback mechanism : A feedback mechanism (or loop) occurs when one change causes another, which in turn affects the original change. In terms of water, explain how the opening of stomate is an example of a feedback mechanism.
Eukaryotes can generateseveral proteins : Eukaryotes can generateseveral proteins from one gene that contains introns and exons. Identify whichprocesses are involved to produce the mature RNAs.
Role in regulation of gene expression inprokaryotes : The following play(s) a role in regulation of gene expression inprokaryotes
Genetic code tablerelating to amino acids to mRNA codons : Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage?
Contains the four postulates of natural selection : Which of these lists contains the four postulates of natural selection?
Nutrientcycling is generally quite conservative : In contrast to ecosystems that are not harvested (e.g., native forest, grasslands), where in nutrientcycling is generally quite conservative, most agriculturalecosystems are net exporters of nutrients inherent in soil. Consider the following barle..
Dna replication take palce in the cell cycle : In an insect's life history, the juvenile undergoes a process of physical change called? When does DNA replication take palce in the cell cycle
Many antibiotics operate by interfering with the ribosome : Many antibiotics operate by interfering with the ribosome.  Tetracyclin, for example, acts by binding to the 30S subunit.  How come we do not die when we take antibiotics if they interfere with protein production?

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd