Find the termination codon for kdgr

Assignment Help Biology

Reference no: EM1395527

1. Find the termination codon for kdgR:
2. Identify the sequence representing 3' UTR:
3. How would you determine the termination codon (from Question #1) appear in the mRNA for this gene? Write the sequence below, with the 5' and 3' ends of the sequence indicate clearly.

ATGGCTAACGCAGATCTGGATAAACAGCCTGATTCTGTATCTTCCGTGCTAAAAGTTTTT
GGCATTTTGCAGGCGCTGGGTGAAGAGCGCGAAATAGGGATAACCGAGCTGTCGCAGCGC
GTCATGATGTCAAAAAGCACCGTTTATCGCTTTTTACAGACCATGAAAACCTTAGGTTAT
GTGGCGCAGGAAGGGGAGTCGGAGAAATATTCCCTGACCCTGAAATTGTTTGAACTGGGC
GCTCGCGCGTTACAAAACGTCGATTTAATTCGTAGCGCAGATATCCAGATGCGTGAGCTC
TCCCGCCTGACCAAAGAAACTATCCACCTCGGCGCACTGGACGAAGACAGTATTGTTTAC
ATTCACAAAATTGACTCTATGTACAATTTGCGCATGTATTCACGGATTGGGCGTCGTAAT
CCGCTGTACAGCACCGCGATTGGTAAGGTACTGCTGGCATGGCGCGATCGCGATGAAGTG
AAGCAAATTCTTGAGGGCGTGGAGTATAAACGCAGTACCGAGCGGACCATCACCAGTACA
GAAGCGTTATTACCCGTTCTGGACCAGGTGCGCGAGCAGGGGTATGGCGAAGATAATGAA
GAGCAGGAAGAAGGGCTGCGATGCATTGCGGTACCGGTATTTGATCGCTTTGGCGTGGTC
ATTGCCGGTTTGAGCATCTCCTTCCCGACGTTGCGTTTCTCTGAAGAGCGTTTACAGGAA
TATGTCGCAATGTTGCATACCGCAGCGCGCAAAATTTCTGCCCAAATGGGTTATCACGAC
TATCCGTTCTGA

Reference no: EM1395527

Questions Cloud

Explain how much did chinese purchases of financial : Assuming which China's net debt forgiveness was zero in 2007 (its capital account balance was zero), by Explain how much did Chinese purchases of financial also real assets abroad exceed foreign purchases of Chinese financial also real assets?

Correlation coefficient and scatter plot : Display the data in scatter plot. Calculate the linear correlation coefficient. Use the scatterplot to make a conclusion about the type of correlation.

Would this event cause the demand for the dollar to increase : Would this event cause the demand for the dollar to increase or decrease relative to the demand for the pound? Explain why?

Sample mean sales to identify shops : Their monitoring plan will take a random sample of 5 days sales per month and use the sample mean sales to identify shops that are under-performing. Establish the lower limit sales such that only 5% of the shops would have a sample sales mean belo..

Find the termination codon for kdgr : How would you determine the termination codon appear in the mRNA for this gene? Write the sequence with the 5' and 3' ends of the sequence indicate clearly.

Elucidate enforceable under the statute of frauds : After she returned home, Jeremy's mother refused to pay the resort. The resort manager tried to collect the sum from Jeremy, but Jeremy also refused to pay, stating which his promise was not enforceable under the Statute of Frauds. Is Jeremy corre..

Appropriate conclusion from survey : A recent survey of frozen convenience meals found a correlation of r=0.768 between calories and fat content in the sampled meals.

Elucidate your answer using legal terminology : Then Ken receives a telegram saying the fellowship has been cancelled. No reason is given for the cancellation. If Ken sues, will he be able to collect the money from the foundation which promised the fellowship? Elucidate your answer using legal ..

Running a more precise experiment : A researcher has reason to believe that, for an experiment with 50 points, a 95% prediction interval would be of width 4. If the researcher wishes to run a more precise experiment that will result in a 95% prediction interval of width 2, then the ..

User Account

All Pages