Find the sequence of amino acids coded for by this mrna

Assignment Help Biology

Reference no: EM1340151

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA
from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

Determine the sequence of amino acids coded for by this mRNA

Reference no: EM1340151

Questions Cloud

Among ethical conduct in a corporation and job : Empirical studies reveal a positive correlation among ethical conduct in a corporation and job satisfaction.

Comparison of two banks : Select two banks and comparison shop for the best deal on a new personal checking account.

Various ways to determine budgets for individual tasks : Consider various ways to determine budgets for the individual tasks. What are the pro's and con's of each method?

Compute the gain from trade but you should discuss : Compute the gain from trade but you should discuss how comparative advantage is used.

Find the sequence of amino acids coded for by this mrna : find the sequence of amino acids coded for by this mRNA.

Explain working conditions : Explain Working Conditions- Parental Leave and Economic Benefits and Given the current economic climate can we really afford to improve working conditions for family

Operating cash flow project generate during its life : What operating cash flow does Datum's project generate each year during its life?

Japanese banks : Banks in Japan are allowed to own stock

Good the us would be considered to have a comparative : Provide one example of a good the US would be considered to have a comparative advantage in producing. Why do you think the U.S. has this comparative advantage.

User Account

All Pages