Find the modulation index and percent

Assignment Help Basic Computer Science
Reference no: EM131383258

An AM signal consists of a 10-MHz carrier modulated by a 5-kHz sine wave. It has a maximum positive envelope voltage of 12 V and a minimum of 4 V.

(a) Find the peak voltage of the unmodulated carrier.

(b) Find the modulation index and percent.

(c) Sketch the envelope.

(d) Write the equation for the signal voltage as a function of time.

Reference no: EM131383258

Questions Cloud

Describe the health concerns of the community : In a report format of 1,250-1,500 words, address the following: Describe the health concerns of the community. Identify current environmental risk assessment methods which apply to public health issues
Database according to research topic : 1. Which is your research topic, and what will be your key concepts when searching the database according to your research topic? 2. Explain what phrasal search is and how you can use this concept to your topic. Can be used truncation for your se..
Discuss cost management as a profession : Discuss cost management as a profession Name three professional cost management organizations and explain their roles. Where in the corporate, not for profit, areas would cost accountants work and what types of work would they do?
Estimate the mass of its dark companion : Binary star The observed period of the binary star Cygnus X-1 (of which only one component is visible) is 5.6 days, and the semi-major axis of the orbit of the visible component is about 0.09 AU. The mass of the visible component is believed to be..
Find the modulation index and percent : An AM signal consists of a 10-MHz carrier modulated by a 5-kHz sine wave. It has a maximum positive envelope voltage of 12 V and a minimum of 4 V.
What should be completed in preparation for octave method : Which one of COBit's focus areas requires risk awareness by senior corporate officers, a clear understanding of the enterprise's appetite for risk, understanding of compliance requirements, transparency about the significant risks to the enterpris..
Explain how cole hardware use technology to manage inventory : Explain how Cole Hardware used technology to manage inventory and identify at least two benefits of the use of this technology by the company.
Concept of the accountable care organization : Do you think the concept of the Accountable Care Organization has traction or is just another fad in the continual pursuit of slowing the growth of health care expenditures
Manufacturing and service environments : Provide a 750-1,000-word summary describing the differences and similarities between manufacturing and service environments. For each company, identify if customer-introduced variability is available.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Is there a need to modify any of the earlier code

Is there a need to modify any of the earlier code?

  Preference of time or frequency domain

1. Consider the audio system in a car. Some people like to hear a lot of bass. Give an equation, in your preference of time or frequency domain, for a bass boost.

  Why did the company issue a press release

Why did the company issue a press release? Wouldn't most businesses want to keep such a huge loss quiet?

  Describe the impact of software development

Explain the technologies that have contributed to the exponential growth of the Internet and the World Wide Web (WWW). Describe the impact of software development, and computing technologies on business productivity

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Design the following for availability and reliability

Prepare a Word document that is between 6-8 body pages in length. Add a title page and abstract. Citations and references must be in APA format. Include diagrams that illustrate your backbone and WAN design.

  Relational database concepts

Describe how a third-generation language (3GL) programming language is used in conjunction with SQL to develop database applications.

  Given a set of n points in the cartesian plane

Design an algorithm for the following problem: Given a set of n points in the Cartesian plane, determine whether all of them lie on the same circumference

  Finding content of top of stack-call instruction is executed

Specify the content of PC, SP, and the top of the stack in the following situations: After the call instruction is executed.

  Write a complete interactive menu-driven program

Write a complete interactive, menu-driven program using the binary file built previously and your primary and secondary indexes in memory.

  Calculate the gain with respect to an isotropic antenna

Calculate the gain, with respect to an isotropic antenna, of a half-wave dipole with an efficiency of 90% that is placed one-quarter wavelength from a plane reflector that reflects 100% of the signal striking it.

  How much profit can acme expect to make on the alpha project

Has the management reserve been revised, and if so, by how much?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd