User Account

All Pages

File managers

Assignment Help Basic Computer Science
Reference no: EM13796699

Unit 2 Discussion 1: File Managers 

There are three main types of file managers used in different distributions of Linux. Orthodox file managers or "Commander-like" file managers have three windows (two panels and one command line window).

The second type is the navigational file manager representing the most common type of file manager available today. The third type of file manager is a spatial file manager which presents files and folders as if they were real objects.

To provide an insight into the quality of software that is available, you will research high-quality, free Linux file managers. Hopefully, you will discover something of interest for anyone who wishes to have more control over managing their files.

Visit the web article 14 of the Best Free Linux File Managers (https://www.linuxlinks.com/article/20081224191928555/FileManagers.html) as a place to begin researching these utilities. Then go explore the 14 file managers that are available.

In your discussion post:

  • Describe four of the file managers from the web article provided above. Include a screenshot of the software in action, a full description with an in-depth analysis of its features, and links to relevant resources and reviews. Cite any sources you use in APA format; this includes sources for any screenshots that are not your own.
  • If you notice that your peers have not covered a specific file manager, please use this as a place to begin your research. As a class, we should be able to cover all 14 through everyone's contributions to the discussion forum.

Please be aware that part of your grade for all Discussion Forums is based on whether you use/cite Sources in answering the original question. (This is worth 10% of your Discussion grade.) Please do some online research for this topic and list references to websites you use in learning about these topics. (Please see the Discussion Participation Policies in the Online Policies and Procedures resources block in Moodle for more info.) Also, please cite your sources and be careful to not plagiarize your answer. (See the News Post I made during Week 1 about how to avoid plagiarism.) (All text taken from sources must be in "quotes".)

Reference no: EM13796699

Questions Cloud

How cisco it provides remote access for small offices : Case Study 2: Cisco's Remote Access Go to Cisco's Website and read, "How Cisco IT Provides Remote Access for Small Offices and Teleworkers", located at http://bit.ly/MkvlbA. According to the study, an IDC forecast from December 2007
Learning curves are related : Short-run losses may be incurred in order to gain the future benefits of lower AC that result from greater knowledge and experience. A balance of stability and change must be maintained in an organization to take advantage of knowledge and experience..
U-shaped AC curve and an L-shaped AC curve : The difference between a U-shaped AC curve and an L-shaped AC curve is that: Diseconomies of scale are greater as represented by the L-shaped AC curve. The Marginal Cost (MC) of production increases more rapidly beyond the minimum efficient scale poi..
Open source licenses : Open source licenses are licenses that comply with the Open Source Definition; in short, they allow software to be freely used, modified, and shared. To be approved by the Open Source Initiative (also known as the OSI), a license must go through the ..
File managers : There are three main types of file managers used in different distributions of Linux. Orthodox file managers or "Commander-like" file managers have three windows (two panels and one command line window).The second type is the navigational file manage..
What are the organization’s overarching goals : What are the organization's overarching goals
Values are supported by specific aspects in the marketing : Describe how an organization's mission statement and values are supported by specific aspects in the marketing, operations, technology, management, and social responsibility sections of a business plan.
Social performance of organizations : According to the textbook, the current world economy is increasingly becoming integrated and interdependent; as a result, the relationship between business and society is becoming more complex. Use the Internet to research one (1) of the following..
Salaries and proposed wage increases of your coworkers. : 1. Take a position on whether or not you believe most employees abide by their organization's AUP. Support your position with an explanation. Propose ways that an organization can enforce this policy. 2. Suppose your department manager accidentally s..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What is polling and interrupts

what is polling and interrupts? Please provide definitions

  What types of threats does the tool mitigate

What types of threats does the tool mitigate?

  Generate a random number from normal distribution

lname must be generated at random using specified uniform distributions, i.e., [X, Y] means that some random value between X and Yis chosen for each record by your implementation.

  Understand the concepts relating to issues

Understand the concepts relating to issues

  Find the mean delay e(t) and the average wait time e(w)

Consider a statistical multiplexer (or a data concentrator) in which the input packets from terminals connected to it are merged in order of arrival in a buffer and are then read out first come-first served over an outgoing transmission link. ..

  Create an html5 document that contains an unordered list

Create an HTML5 document that contains an unordered list with links to the following examples headings, email, images as hyperlink these are from textbook, special characters, tables, HTML5 forms, and internal links to be included

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Discrete math problem

Discrete Math problem.What is the number of subsets of {a,b,c,d,e,f,g,h} containing exactly 3 elements?

  Application letter and resume

In this project, you will work with a fax cover sheet, an application letter, and a resume. To complete the project you will create a table, add text to a table, and format tables.

  What are two backup freeware

What are two backup freeware, shareware or commercially available backup programs and compare them and the default Windows backup program to explain the pros and cons of the three programs.

  What is the global cpi for each implementation?

Given a program with a dynamic instruction count of 1.0E6 instructions divided into classes as follows: 10% class A, 20% class B, 50% class C, and 20% class D, which implementation is faster?"

  Display the lowest number of moves

Display the lowest number of moves it took for the mole to escape and how many times did the mole escape in that fewest number of moves?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd