Explain what will be each party batna

Assignment Help HR Management
Reference no: EM132747487

Case study

  • Nik and Andy are colleagues working at a multinational automotive company in Malaysia. Both is a Regional Manager for Kuala Lumpur and Sabah. An advertisement has been placed on the company's and major recruitment's website to employ a new Country Manager located in Seoul, South Korea. Both want to negotiate with General Manager, Mr Ravi, that they would excel and get promotes as "Country Manager", from their current position as regional manager. This position will provide either one of them with many opportunities and benefits such as higher salary with more responsibilities and utilizing more of their technical and leadership skills.
  • Besides, both have been working for the company for more than 5 years as a full-time employee and have made an enormous contribution to the organization. From their experience, they have also determined that Mr Ravi is "conscientiousness" personality as per the "Big Five" personality type.
  • Nik is married but has no children. His wife is working as a medical practitioner in a government hospital in Kuala Lumpur. Nik is keen to try for the position as he knows that it will be a golden opportunity for him. However, he has not yet to discuss with his wife as they don't get a chance to sit together due to his wife busy working schedule. With thought that his wife will be fine with his decision to try for the position, Nik decided to proceed to apply and will let her know afterwards
  • Andy is an extraversion personality which he likes being sociable, assertive, and talkative. He found himself is among the suitable candidate to apply for the country manager position. However, he has trouble to suit himself with Korean food. He once was food poisoning when eating the local food from a Malaysian Korean Food Chain in Kota Kinabalu. Without hesitation, Andy thinks that he could counter that problem because he could find other types of cuisine in Seoul easily. He also thinks that it was a small issue that could hamper his work performance if he gets the country manager position.
  • Assume you are in Nik, Andy and Mr Ravi place.

Problem 1. What would be each party's negotiation process? State either integrative or distributive for each party in each scenario. Explain the relationship characteristic of parties in the scenario.

Problem 2. What will be each party's BATNA? Identify the BATNA for each party in each scenario. Is there any dilemma(s) faced by each party?

Reference no: EM132747487

Questions Cloud

What steps can the company take to increase the likelihood : In order to complete assignment #8 you will need to answer the below questions. Please complete the questions in a Word document and then upload the assignment.
Explain why most plants appear green : Using the concepts of aerobic and anaerobic respiration, explain why a person can only perform an all-out sprint for only about 30 seconds but another
What are the essential techniques and strategies : What are the essential techniques and strategies in the context of negotiation? Explain in detail. State the type either integrative or distributive
Access Control Models : If you were going to design an access system that would control people getting into your favorite or most valued items
Explain what will be each party batna : What will be each party's BATNA? Identify the BATNA for each party in each scenario. Is there any dilemma(s) faced by each party?
Represent complementary strand produced during replication : What would represent the complementary strand produced during replication? (write out the correct sequence and indicate 3' and 5' ends)
Health care administrator functions within system : A health care administrator is a leader and manager. When implementing a health care information system,
Explain the role of the thesis : Finish the term paper using the following outline. In addition to the 4-6 pages of the paper itself, you must include a title page and a reference page.
Identify the new strand of dna : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine

Reviews

Write a Review

HR Management Questions & Answers

  Improve problem solving capabilities within organization

Types of teams as to their effectiveness that will improve problem solving capabilities within organizations.

  Influence tactics help in reducing organizations politics

Explain the different types of influence tactics that will be of a help “if adopted” in reducing the organizational politics.

  Report on citigroup''s hr service level agreement

Human Resources or Human Resource Management deals with HR Service Level Agreement. HR Service Level Agreement is an agreement made between the employer and the employee, which states that the employee would work under any client and sometimes any ti..

  A project report on hrm

Human Resource Management as the name suggests, it is a management discipline which deals with the human i.e. the workforce aspect of organizations. Need and practices of HRM are inevitable in present scenario of extreme competition where "Talent War..

  Hrp: recruitment and selection

Recruitment and Selection is the initial ladder of any Human Resource Planning process and contains an immense significance for any organisation.

  A project report on study of statutory complainces

Statutory compliance and its immense knowledge are crucial to be understood in an organization. It contains all the forms, procedures and acts applicable in a company.

  Operant conditioning and Reinforcement

Operant conditioning is a learning process where behaviour is controlled by its consequences. In this process an individual's behaviour can be modified through the use of positive or negative reinforcement.

  Effectiveness of training programs in achieving customers an

The main motive for conducting this research is to provide broad range of research of the literature and their reviews related to training and development and assisting the employees in providing customers satisfaction.

  A critical analysis of hr processes and practices in fedex c

FedEx is illustrious for its novel HR processes and practices that have greatly accounted for its success.

  Integrating culture and diversity in decision making

People in the organization are known as Google where they share common goals and have common vision.

  Impact of employee attrition on people management in organis

Talent management implies recognizing a person's inherent skills, traits, personality and offering him a matching job.

  Labour dissonance at maruti suzuki india limited: a case stu

This Case Study focuses on various issues related to Labour Unrest at Maruti Suzuki India Limited.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd