Explain what will be each party batna

Assignment Help HR Management
Reference no: EM132747487

Case study

  • Nik and Andy are colleagues working at a multinational automotive company in Malaysia. Both is a Regional Manager for Kuala Lumpur and Sabah. An advertisement has been placed on the company's and major recruitment's website to employ a new Country Manager located in Seoul, South Korea. Both want to negotiate with General Manager, Mr Ravi, that they would excel and get promotes as "Country Manager", from their current position as regional manager. This position will provide either one of them with many opportunities and benefits such as higher salary with more responsibilities and utilizing more of their technical and leadership skills.
  • Besides, both have been working for the company for more than 5 years as a full-time employee and have made an enormous contribution to the organization. From their experience, they have also determined that Mr Ravi is "conscientiousness" personality as per the "Big Five" personality type.
  • Nik is married but has no children. His wife is working as a medical practitioner in a government hospital in Kuala Lumpur. Nik is keen to try for the position as he knows that it will be a golden opportunity for him. However, he has not yet to discuss with his wife as they don't get a chance to sit together due to his wife busy working schedule. With thought that his wife will be fine with his decision to try for the position, Nik decided to proceed to apply and will let her know afterwards
  • Andy is an extraversion personality which he likes being sociable, assertive, and talkative. He found himself is among the suitable candidate to apply for the country manager position. However, he has trouble to suit himself with Korean food. He once was food poisoning when eating the local food from a Malaysian Korean Food Chain in Kota Kinabalu. Without hesitation, Andy thinks that he could counter that problem because he could find other types of cuisine in Seoul easily. He also thinks that it was a small issue that could hamper his work performance if he gets the country manager position.
  • Assume you are in Nik, Andy and Mr Ravi place.

Problem 1. What would be each party's negotiation process? State either integrative or distributive for each party in each scenario. Explain the relationship characteristic of parties in the scenario.

Problem 2. What will be each party's BATNA? Identify the BATNA for each party in each scenario. Is there any dilemma(s) faced by each party?

Reference no: EM132747487

Questions Cloud

What steps can the company take to increase the likelihood : In order to complete assignment #8 you will need to answer the below questions. Please complete the questions in a Word document and then upload the assignment.
Explain why most plants appear green : Using the concepts of aerobic and anaerobic respiration, explain why a person can only perform an all-out sprint for only about 30 seconds but another
What are the essential techniques and strategies : What are the essential techniques and strategies in the context of negotiation? Explain in detail. State the type either integrative or distributive
Access Control Models : If you were going to design an access system that would control people getting into your favorite or most valued items
Explain what will be each party batna : What will be each party's BATNA? Identify the BATNA for each party in each scenario. Is there any dilemma(s) faced by each party?
Represent complementary strand produced during replication : What would represent the complementary strand produced during replication? (write out the correct sequence and indicate 3' and 5' ends)
Health care administrator functions within system : A health care administrator is a leader and manager. When implementing a health care information system,
Explain the role of the thesis : Finish the term paper using the following outline. In addition to the 4-6 pages of the paper itself, you must include a title page and a reference page.
Identify the new strand of dna : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine

Reviews

Write a Review

HR Management Questions & Answers

  Trends and challenges paper and presentationprepare a paper

trends and challenges paper and presentationprepare a paper discussing existing trends and challenges in hr management.

  Define why employment laws were developed

To understand why employment laws were developed, let's look at a prominent, tragic incident in labor history. Read/watch a description of the event.

  A training event in your organization

Question 1. You have just been assigned a training event in your organization. Since the training event will consist of purely adults, explain the considerations you should take into account. Your response should be at least 200 words in length. You ..

  Describe your interviewees position and type of organization

Describe your interviewee's position (role, responsibility) and type of organization where he or she works. What did you discover about the topics interrelated to developing a culturally competent and diverse organization?

  Analyze case related to strategic hr resource management

You worked with a group to analyze a case study related to strategic human resource management. In the Assignment Forum, you were asked to select the appropriate case study thread and add your group's case study as an attachment. You were to inclu..

  Job analysis for teams

Which of the following is not a good reason for using an outside consultant for job analysis?

  HR field concerning performance appraisals

For years, there has been a debate in the HR field concerning performance appraisals. Some believe appraisals are ineffective and outdated while others believe they help provide a solid foundation for determining an employee’s compensation package. P..

  Evaluate the current technology and scm systems

Evaluate the current technology and SCM systems utilized by e-business. Research potential new markets or suppliers that can be used to grow the e-business.

  Show the reasons for the arc''s ethical dilemma

What are the reasons for the ARC's ethical dilemmas, and explain how can the organization guarantee that these problems will not recur in the future?

  What are the goals of the organization

Research the organizational structure of the United Nations Human Rights Council. What are the goals of the organization? How is it structured to accomplish.

  How to implement the training and knowledge

In order to begin the design for a training module for someone in the automotive field I would first need to research the most important components.

  Top management influence

The Together Support (TS) charity is a well-known charity in the region. Senior management is often involved with TS at a community level.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd