Explain what strict liability means in criminal law

Assignment Help Business Law and Ethics
Reference no: EM133208923

Question - At the end of each chapter, the textbook contains various assessment activities. Review those activities as a means of self-assessment. Do you feel confident with your understanding of the chapter objectives? If so, proceed to the assigned questions for this week. If you have questions or concerns, let's discuss them in ASK?'s before moving forward with this assignment.

Instructions - Answer each of the questions provided below. The textbook should be referred to for a general understanding of each concept. However, every response must be answered with information obtained from primary authority or a secondary scholarly source through Westlaw or LIRN. Sources cannot be used more than once. If there are five questions, then five different sources are required.

Question One -

1. Explain each the five purposes (i.e. rationales) for punishment. Explanation must come from a secondary scholarly source obtained from Westlaw or LIRN.

2. Select the one purpose / rationale that is most effective (you may base the decision on your opinion, but it must be drafted in third person without ever using "I"). Support your response with at least one primary authority from Westlaw.

3. Find a law review article or scholarly article where that purpose was reviewed or studied. Discuss the article's conclusions.

4. Provide properly formatted citations to all sources. They must be embedded within your content, as per the Bluebook Practitioner Rules.

Question Two -

1. Define, compare, and contrast assault and battery. Explanation must come from a secondary scholarly source obtained from Westlaw or LIRN.

2. After explaining the difference(s), provide a short summary of your state's criminal / penal statute on the crime of battery. Cite that statute. Westlaw must be used to retrieve the statute.

3. Discuss a case (i.e. a judicial opinion / case law) from your home state where the defendant was found guilty of battery. The case must come from Westlaw. Discuss the facts from the case and the court's rationale (i.e. reasoning) for concluding that the defendant did in fact meet the elements of battery.

4. Provide properly formatted citations to all sources. They must be embedded within your content, as per the Bluebook Practitioner Rules.

Question Three -

Go to the Death Penalty Information Center. Access the Fact Sheet which is located under: Facts and Research.

1. Discuss information that might have surprised you or that you found interesting. You would use the "Fact Sheet" as your source. Provide a properly formatted citation.

2. Discuss the information from that site regarding cruel and unusual punishment as it applies to capital punishment. Again, a properly formatted citation must be provided.

3. Based on your personal point of view regarding the death penalty, find a law review article (Westlaw) or scholarly article (LIRN) in favor of or against the death penalty. Briefly summarize the findings from that article.

4. Provide properly formatted citations to all sources. They must be embedded within your content, as per the Bluebook Practitioner Rules.

Question Four -

1. Define, compare, and contrast constructive possession versus actual possession. Explanation must come from a secondary scholarly source obtained from Westlaw or LIRN.

2. Find a case from your state where the defendant was found guilty for the constructive possession of an illegal substance. The case must come from Westlaw. Discuss the facts from the case and the court's rationale (i.e. reasoning) for concluding that the defendant did in fact meet the criteria for constructive possession.

3. Provide properly formatted citations to all sources. They must be embedded within your content, as per the Bluebook Practitioner Rules.

Question Five -

1. Explain what strict liability means in criminal law. Support your explanation with a primary authority or a secondary scholarly source from Westlaw.

2. Find a case from your state where the defendant was found guilty of a strict liability offense. The case must come from Westlaw. Discuss the facts from that case and the court's rationale (i.e. the reasoning to find the defendant guilty of the strict liability offense).

3. Are you in favor of crimes that do not require mens rea (i.e. strict liability offenses)? Do not use "I" to draft your argument; rely solely on the source being cited to draft your response. Support your argument with a secondary scholarly source from Westlaw or LIRN. Remember, the source must be your voice.

4. Provide properly formatted citations to all sources. They must be embedded within your content, as per the Bluebook Practitioner Rules.

Reference no: EM133208923

Questions Cloud

Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house
Apply the relevant cogdon facts to the case you discussed : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed
Explain what strict liability means in criminal law : Explain what strict liability means in criminal law. Support your explanation with a primary authority or a secondary scholarly source from Westlaw
Has tech savvy corp made sufficient : Question - An exciting new company, Tech Savvy Corp., designs and builds printer consoles. Has Tech Savvy Corp made sufficient
Discuss the facts from that case, the court''s reasoning : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed
Is carla in breach of her duty : At the same time, Carla continues to aggressively market her artwork and sells several pieces on her own. Is Carla in breach of her duty
Advise Ms Elizabeth about her Capital Gain : You are required to advise Ms Elizabeth about her Capital Gain and her tax responsibility towards each asset

Reviews

Write a Review

Business Law and Ethics Questions & Answers

  Legal environment of business caselet

The assignment in Law deals with the topic "Legal Environment of Business". A case study about Mary, a newly joined employee who is working in the USA and Europe. She faces few issues at her work place in Europe and tries to talk to her manager who s..

  Business ethics & legal issues caselet

This assignment is about the concept of Business Ethics & Legal Issues. The laws relating to these can be found in Antitrust laws. These laws are concerned with those large corporations which have a majority of market share, mergers and acquisitions.

  Questions on business law and ethics

Examples of securities that are exempted from the registration provisions of the 1933 Act and involving misstatement of material facts in a prospectus.

  Discuss the doctrine of ratification of pre-incorporation

With the aid of a decided cases, discuss the doctrine of ratification of pre-incorporation contract.

  Discuss the extent of phoenixing activity

It has been estimated that about 6,000 phoenix companies operate in Australia, costing government and the community hundreds of millions of dollars per year and impacting on individuals.

  Application of law to facts

Company Law, Application of Law to Facts and Conclusion.

  Question on business law and ethics

This assignment related to business law.

  Questions on business law

Answer all the questions under business law.

  Iidentify the issue raised by the facts

Iidentify the issue(s) raised by the facts, identify the relevant legal principles, apply the relevant legal principles to the facts, reach a conclusion.

  Evaluation of software development

Prepare a report and present an evaluation of the subsequent methodologies for software development in terms of cost, resources and time.

  Business value and ethics

Business value and ethics,  Bart agrees to put Sam's Super Bowl champion-ship autographed football in his sports store to sell for $1,500. Sam agrees to pay Bart a 15% commission for selling the ball. If Joe comes in the sports store and offers Bart ..

  Explain what is meant by income by ordinary concepts

Advise what tax consequences arise in respect of the payments.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd