Explain the role of the thesis

Assignment Help Other Subject
Reference no: EM132747484

Assignment: Finish the term paper using the following outline. In addition to the 4-6 pages of the paper itself, you must include a title page and a reference page. You are to follow APA Guidelines for citing and referencing sources. Your paper must be in your own words, representing original work. Paraphrases of others' work must include attributions to the authors. Limit quotations to an average of no more than 3-5 lines, and use quotations sparingly. It is always better to write the information in your own words than to directly quote.

Title: Penalties and adjudication for various information and technology offenses.

Thesis: Penalties and adjudication for various information and technology offenses are not playing the crucial role of securing the abolition of breaching the law, which has been set, to safely guide the key players in the platform. The law is not even ensuring that those people who temple with the originality of a given person work.

i. Introduction

a. Thesis

b. The role of the thesis.

ii. Expounding on the law and some of the changes needs to make it better.

a. Background of the law

b. Some of the recommendation that has been pointed out concerning the law by different stakeholders.

c. The effects of the law on today's information and technology industry.

iii. The main objectives of the law.

a. The success and the future of IT in the country

b. The goals of addressing the topic

c. The significance of the law and the setbacks

d. The significance of implement the law to the grass root.

iv. The benefit of law to the industry

a. The key traits of for success

b. The goal of the law

c. Efforts to introduce new laws and ensuring they have been followed.

i. Significance of changing some articles in the law

ii. Incorporating of organs to ensure that the effectiveness of the law

d. Making sure that the law meets the national and international standards

v. Recommendation from the writer's view.

a. Some of the things that can make a difference in the information and technology sector.

vi. Conclusion

a. Summarizing the arguments and efforts made

Reference no: EM132747484

Questions Cloud

Access Control Models : If you were going to design an access system that would control people getting into your favorite or most valued items
Explain what will be each party batna : What will be each party's BATNA? Identify the BATNA for each party in each scenario. Is there any dilemma(s) faced by each party?
Represent complementary strand produced during replication : What would represent the complementary strand produced during replication? (write out the correct sequence and indicate 3' and 5' ends)
Health care administrator functions within system : A health care administrator is a leader and manager. When implementing a health care information system,
Explain the role of the thesis : Finish the term paper using the following outline. In addition to the 4-6 pages of the paper itself, you must include a title page and a reference page.
Identify the new strand of dna : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine
What is the implied exchange rate at maturity : A comparable risk five year, 5.5 percent yen/dollar dual currency bond pays $833.44 at maturity per ¥100,000 of face value. What is the implied exchange rate
State which eylf practice links best : State which EYLF Practice links best. The ECA Code of Ethics and the United Nations Convention on the Rights of the Child support play
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation? What is the type and pathological changes of chronic gastritis?

Reviews

Write a Review

Other Subject Questions & Answers

  Discuss economic development project in your community

Select an economic development project in your community. The project must have been implemented and/or completed within the past 10 years. Provide background.

  Intellectual stimulation and idealised influence

Intellectual Stimulation - This, to me, is allowing the athletes a say in part of the leadership and decision-making in the program.

  Find out effect the event has had on subjective well-being

choose the significant event either positive or negative which occurred before you reached adulthood and that has had

  What are two legal issue associated with clinical psychology

What are at least two legal issues associated with clinical psychology? Provide an example of a situation that could be legal but unethical. Explain your response.

  How does mill define happiness

How does Mill define ‘happiness'? Are all pleasures the same or are some pleasures determined to be more valuable to a human life than others?

  The criminal justice system

Do you think it should be required for people to take a lie detector test or become hypnotized to become either a police officer or to hold a position

  How can attending events-meetings or conferences relevant

In two paragraphs. How do you plan on taking advantage of the online forums available to you as a graduate student? How can attending events, meetings, or conferences relevant to the industry you work in (or would like to work in) assist you in stayi..

  What determines ones sexual orientation

Why is it important to understand what determines one's sexual orientation? Consider ethical, legal, and social implications. If you do not think it is important to understand the origins, please explain.Based on what you have learned in your rea..

  Discuss the economic and global financial crisis

Provide overview with significance of the issue related to The Economic and Global Financial Crisis

  Demonstrate how the evidence supports the thesis

Effective reasoning that demonstrates how the evidence supports the thesis and the specific arguments being made - A logical organizational structure that clearly and effectively guides readers through the arguments being made

  How to close the health care disparities gap

Discuss how to close the health care disparities gap in the LGBTQ community? Your initial post should be at least 500 words, formatted and cited in current APA.

  Difference between induction and deduction

Describe the difference between induction and deduction. Which approach to reasoning,

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd