Draw the corresponding mrna sequence

Reference no: EM13145279

A double stranded DNA moelcule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.

TACATGATCATTTCACGCAATTTCTAGCATGTA
ATCTACTAGTAAAGTGCCTTAAAGATCGTACAT

a) Which strand of DNA is transcribed and in which direction? Show your reasoning.

b) Draw the corresponding mRNA sequence and use the genetic code to derive the amino acid seq of the 5 amino acid peptide that is produced.

Reference no: EM13145279

Questions Cloud

Basics of journal entries to record the sale of equipment : Prepare Beka Company's journal entries to record the sale of the equipment in these four independent situations.

What is the formula to calculate lake morphometrics : What is the formula to calculate lake morphometrics?

Describe what would an overall underlying theme : Describe what would an overall underlying theme that connects all body systems.

Journal entry to record transaction by perpetual inventory : On December 1, 2008, ABC Linens sold merchandise which costs $400 on account to the Green Hotel Co. for $600 with terms of 3/10, n/30. ABC Linens uses a perpetual inventory system. The journal entry to record this transaction on ABC Linens' books ..

Draw the corresponding mrna sequence : Which strand of DNA is transcribed and in which direction? Show your reasoning.

Find the mean of annual household incomes of city : The city are below $25,000. Find the mean of the annual household incomes of this city. It is assumed that the annual household incomes follow a normal distribution.

Explain the basics of accounting : Your father runs a small auto body shop. He has decided to computerize his records and has asked you to explain the basics of accounting to him so that he can enter the data into his accounting software.

What is the value of the equilibrium constant : For the reaction:2CH4(g) C2H2(g) + 3H2(g) 0.115 mole of CH4 was placed in a 1.00 L container. At equilibrium it was found that the [C2H2] = 0.035 M. What is the value of the equilibrium constant?

Financial catastrophe : The project would focus on exploring how the different schemes have catered for different population groups, both in terms of enrollment and in terms of access to services.

User Account

All Pages