Draw a plant cell and state the function of each organelle

Assignment Help Biology
Reference no: EM131778652

Essay Assignment

Part A. Answer all question

A result of recent developments in fuel cell technology, serious consideration is given to direct alcohol fuel cells in which alcohol is used directly as the fuel. Methanol and ethanol are the most promising fuels for transportation applications. To assess the environmental benefits of these fuel choices over petroleum, it is important to analyze their energy uses and emissions during the fuel cycle. Evaluation of greenhouse gas emission is being taken in to consideration in order to evaluate the efficiency of each type of fuel cells. In this experiment only, CO2 was used as a variable. Amount of CO2 in grams per kilometer of driving is used as a unit of measurement.

Type of fuel cell

Amount of CO2 (g/Km)Trial 1

Trial 2

Trial 3

Ethanol

200

185

253

Methanol

180

155

172

Petroleum

250

379

227

Make a bar graph with the information given above and take a conclusion from your data.

Answer only four questions.

01. Compare and contrast all three categories of carbohydrates.

02. Red(R) color is dominant over white color (r) flower petals. Long petal (L) is dominant over short petals. Traits color and length are located on chromosome number 4 and 5 respectively. What are the probability of all genotype and phenotypes of the F1 generation when two heterozygote flowers are crossed.

03. Draw a plant cell and state the function of each organelle.

04. Explain the Miller-Urey experiment and its' significance

05. What is the primary amino acid sequence of the following DNA sequence

DNA- "AGCATGTTACCCATTGATGGGGGATAA"

Reference no: EM131778652

Questions Cloud

Write a analysis of case study : What theory do you agree with? How would that theory determine or influence the recommendation for action?
Introduced the one-child policy : Was it fair for the Chinese government to impose a one-child per family limit on Chinese society? Explain your answer.
Prepare a three-column comparative income statement : Prepare a three-column comparative income statement that reports the following; Annual income without the special order
Develop analogy between something biological or contemporary : Develop analogy between something biological and something contemporary. How the compare and contrast over time?
Draw a plant cell and state the function of each organelle : Draw a plant cell and state the function of each organelle. Explain the Miller-Urey experiment and its' significance.
How have humans adapted to the two habitats and niches : How have humans adapted to the two habitats and niches? What difficulties might you have living in the assigned niche and why?
The purpose of the program or project : Share your written proposal with your manager, supervisor or other colleague in a formal leadership position within a health care organization.
Dropped in the atlantic ocean : Suppose you are a particle of water dropped in the Atlantic Ocean off the coast of Florida. Describe the path you may take to get to one of the following.
Four types of precipitation processes : Please explain and compare the four types of precipitation processes (Rain, Snow, Sleet, etc. are precipitation types, not the types of precipitation processes)

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd